1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
15

A condition in which inadequate intake of vitamin b12 or folic acid causes production of large abnormal red blood cells is calle

d
Biology
1 answer:
quester [9]3 years ago
7 0
The correct answer is "megaloblastic anemia".

In the event of deficiency of folic acid and/or vitamin B12, there will be inhibition of DNA synthesis in red blood cell precursors as well as other cells in the myeloid lineage. This results to continuous cell growth without cell division leading to large, immature red blood cells (hence the term megaloblastic) with low hemoglobin levels. Vitamin B12 deficiency particularly causes neuropathic symptoms such as neuropathic pain and numbness.

If megaloblastic anemia is caused by the resection of the portion of stomach that produces the intrinsic factor (important in the absorption of vitamin B12), then the condition is called pernicious anemia.
You might be interested in
Why do populations have variation of certain traits
HACTEHA [7]
To know where it rightfully belongs to. Variation of certain traits is caused by multiple factors of an individual of the same kind. Depending on their physical appearance, their environment and nature of survival.

Hope this might help.
3 0
3 years ago
Read 3 more answers
Juan has been diagnosed with mono, and the doctor wants to determine if his spleen is enlarged. Where (quadrant, etc.) will the
hichkok12 [17]

Answer and Explanation:

  • Where (quadrant, etc.) will the doctor palpate Juan's abdomen?

<em>Under normal conditions in general the spleen can not be palped because of its reduced size. But when it is enlarged it might be easily touched. The spleen is located under the thoracic cage (rib cage) on the left side, between the 8th and 11th ribs. This would correspond to the left superior quadrant (left hemi-belly).</em>

  • What other organs might be compressed by Juan's enlarged spleen?

<em>The enlargement of the spleen and the liver inflammation are symptoms of the mono disease. This enlargement might affect some neighboring organs such as the stomach, which might be displaced and compressed. </em>

  • why is Juan's spleen enlarged and not his stomach or kidney?

<em>The spleen is part of the immunological system and helps the body to fight infections and filter old bloody cells taking them out of the blood current. This organ might get enlarged because blood cells accumulate in its interior. Red blood cells are excessively stored in the spleen, resulting in anemia. The more cells the spleen retains, the larger it becomes, and hence, the more blood cells it retains and destroys. If the spleen is unproperly working, it kills too many red blood cells and accumulates many others.</em>

The Stomach and kidney are not part of the immunity system and they do not filter blood cells, so they do not seem to be affected by their accumulation.

6 0
3 years ago
Low levels of the neurotransmitter _____ appear to contribute to aggression.
valkas [14]
Low levels of the neurotransmitter serotonin may appear to contribute to aggression. Dopamine and serotonin are the most hormones that are linked with aggression, that is low level of serotonin  and high levels of dopamine. The normal effect of serotonin is the inhibitory effect on aggression levels when at normal levels. At the pre-Frontal Cortex serotonin is usually found at its lowest levelsnand increases aggression. 
5 0
3 years ago
Read 2 more answers
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
There is a large population of rabbits that live on an island. The population consists of one species that has bright red fur. A
Viefleur [7K]

If they find them unattractive there's a probability they wouldn't mate because they are different species and genera

8 0
3 years ago
Other questions:
  • Writers often use description to create a mood or establish a theme. What theme does Woolf establish in the opening paragraph? t
    8·1 answer
  • He level of dna packaging brought about by the formation of _____ looks like beads on a string.
    11·2 answers
  • Give three examples of of potential energy converted to kinetic energy.
    13·1 answer
  • Acid rain is mostly a problem in the _____.
    5·2 answers
  • A scientist conducts an experiment to test a hypothesis. The experiment confirms that the hypothesis could be true. When will th
    12·2 answers
  • What are offspring from a cross between two different plants called?
    12·2 answers
  • Plant spores are usually
    12·1 answer
  • The hormones secretin and cholecystokinin target the pancreases. ---, and, ----to release juice and bile into the small intestin
    10·1 answer
  • What's the term that describes all the chemical reactions taking place in an orgasm
    7·1 answer
  • Using the following nucleotide sequence, predict the complementary strand sequence:
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!