1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
15

A condition in which inadequate intake of vitamin b12 or folic acid causes production of large abnormal red blood cells is calle

d
Biology
1 answer:
quester [9]3 years ago
7 0
The correct answer is "megaloblastic anemia".

In the event of deficiency of folic acid and/or vitamin B12, there will be inhibition of DNA synthesis in red blood cell precursors as well as other cells in the myeloid lineage. This results to continuous cell growth without cell division leading to large, immature red blood cells (hence the term megaloblastic) with low hemoglobin levels. Vitamin B12 deficiency particularly causes neuropathic symptoms such as neuropathic pain and numbness.

If megaloblastic anemia is caused by the resection of the portion of stomach that produces the intrinsic factor (important in the absorption of vitamin B12), then the condition is called pernicious anemia.
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
The movement of ocean water is caused by several processes. _________ results in the continual circulation of ocean water on a g
dem82 [27]

B. Convection

The heat causes the ocean water movement to continuously circulate around the globe

3 0
3 years ago
Read 2 more answers
7. Calculate the density of a liquid with a volume of 13 mL and a mass of 6.94 grams. Round your
Masja [62]

Answer:

Density = mass/volume = 57g/4.2 mL ≈ 13.6 g/mL

Explanation:

Mass = 57 g                              Volume = 4.2 mL

The density of mercury is ⇒ 13.6 g/cm3.

Trust me I got it wrong and it gave me this. I just did the instruction.

6 0
3 years ago
Which of the following increase genetic variation during meiosis or sexual reproduction?
Afina-wow [57]

Answer:

A) all are correct

4 0
3 years ago
According to Sternberg, _____ love has strong components of sexuality and infatuation, and it often predominates in the early pa
geniusboy [140]

Answer: Romantic

Explanation:

In the Sternberg's theory of love, love is described on three different scales. The three different types of love described by Sternberg were based on intimacy, passion, and commitment.

Sternberg said that Romantic love involves intimacy and passion but lacks commitment. Romantic love has strong components of sexuality and infatuation. Usually romantic love is stronger at the early stages of a relationship.

6 0
2 years ago
Other questions:
  • These compounds store genetic information.
    15·1 answer
  • Proteins are mostly absorbed as A. fatty acids. B. disaccharides. C. amino acids.
    15·1 answer
  • Which of the following is NOT an example of an organ system?
    9·1 answer
  • Why do many animals in temperature countries grow thick coats before winter?​
    9·1 answer
  • A species of moth has evolved a very long tongue to reach nectar at the bottom of a species of orchid. This orchid has evolved a
    15·2 answers
  • What is algor mortis?
    8·2 answers
  • Which of these statements best describes how living things appeared on Earth? Viruses evolved into plants by spontaneous process
    5·2 answers
  • How do environmental factors influence genetic traits?
    14·2 answers
  • What happens to the gravitational force exerted by one object on another when the mass of the objects is doubled?
    6·1 answer
  • Could more people be supported by 20 acres of land if they ate only plants instead of both plants and animals
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!