1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
malfutka [58]
3 years ago
15

What is a life half I’m so lost

Biology
2 answers:
DiKsa [7]3 years ago
6 0

Answer:

the answer would be the 3rd answer

Explanation:

a half life is the time it takes for half of a radioactive substance to decay

I hope this helps :)

alina1380 [7]3 years ago
5 0
It is the third answer
You might be interested in
When water molecues are being evaporated through the leaves, the water column is pulled upward due to adhesion of water molecule
fomenos

Explanation:

The answer is F...because h2o molecules are heavier than the atmosphere it surrounds. Therefore, gravity takes over. plse correct me if wrong.

because of gravity, h2o is directed down. That's how plants survive, Remember, ..what goes up, must go down...per " isaac newton."

6 0
3 years ago
The state in which all body systems are functioning smoothly and in equilibrium is __________.
masya89 [10]
<span>The state in which all body systems are functioning smoothly and in equilibrium is homeostasis.</span>
6 0
4 years ago
Claim and evidence:
puteri [66]

It would happen that the effectiveness of an original vaccine could become less if there was a mutation in the virus that caused the protein spike to change because the antibodies created would not be specific for the new virus.

<h3>What would happen to the mutated virus?</h3>

Vaccines trigger an immune response to fight disease-causing organisms, a mutation in the virus to be fought would change the effectiveness of this immune response, as the specificity would not be the same with the mutant virus.

With this information, we can conclude that The immune response would not be specific for the new virus that caused the protein spike to change.

Learn more about Vaccines in brainly.com/question/6683555

#SPJ1

4 0
2 years ago
Name the different types of this monomer that make up dna
djyliett [7]

Adenine

Thymine

Cytosine

Guanine

8 0
3 years ago
WILL MARK BRAINLIEST what is the symbol for nitrogen? Also who wanna talk?
kirill [66]

Answer:

the symbol for nitrogen is N

Explanation:

6 0
4 years ago
Read 2 more answers
Other questions:
  • List the four macromolecules
    7·2 answers
  • Plasma membrane phospholipids are labeled with a fluorescent tag and then the phospholipids in one area are bleached with a lase
    12·1 answer
  • What is the energy released during cell respiration
    11·2 answers
  • Why do warmer and wetter biomes have higher net primary productive??
    15·1 answer
  • An act of fertilization in which genetic information is transferred between cells is called _____. external fertilization intern
    6·2 answers
  • Based on the information provided, in which domain would the organism be classified?
    10·1 answer
  • An atom with 2 protons 1 neutron, and 2 electrons into a cation
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The cell theory states that all cells arise from existing cells. Which scientist first
    13·1 answer
  • What is greenhouse gas?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!