1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
2 years ago
12

I need help with this IMMEDIATELY I will give 20 points and give a brainliest answer if someone answers it. PLZ HELP ME NOW!!! W

ITH BIOLOGY!!!

Biology
2 answers:
icang [17]2 years ago
7 0
I think(it can be incorrect) C option because proteins are embedded in the cell membrane according to fluid mosaic so there is complete place for proteins or carbohydrates
Ivahew [28]2 years ago
6 0

Answer: I love to help I wasn't sure but I look the question up and A is the most that popped up. So I hope this helps And truly sorry if it's wrong also PLEASE DON"T MAKE ME BRAINLIEST.

Explanation:

You are beautiful. You are amazing. You are wonderful. You are perfect just the way you are. Never worry about the way people think about you. Only worry if you like you. You are the most important person to yourself. Just be yourself. No can tell you who you can be. You are truly perfect just the way you are. Never tell yourself you are not good enough, you are enough. Never tell yourself "I'm ugly" you are beautiful. Never let yourself down.

You might be interested in
With which atoms does carbon most frequently bond
Sever21 [200]
Hydrogen is more frequently bonded with Carbon.
7 0
2 years ago
What makes acid rain chemically
svlad2 [7]
Acid rain<span> is caused by a </span>chemical<span> reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other </span>chemicals<span> to form more </span>acidic<span> pollutants, known as </span>acid rain<span>.</span>
6 0
3 years ago
Which of the following is NOT a nitrogenous base?<br> adenine<br> thymine<br> guanine<br> alanine
Kipish [7]

Answer:

Explanation:

Alanine is the correct answer

4 0
3 years ago
Read 2 more answers
Paul had chicken pox when he was 5 years old. nicholas received the chicken pox vaccines. which type of immunity does each man h
GrogVix [38]

Answer:

Paul has natural active immunity, while Nicholas has artificial active immunity.

Explanation:

Natural active immunity is an immunity that occurs when an individual is exposed to a disease causing organism, gets infected, and also become immune to the disease due to the primary immune response. From the question, Paul has natural active immunity because he had chicken pox before, and the virus that causes chicken pox has interacted with his immune response, hence, making him to develop natural immunity to the disease.

Artificial active immunity is an immunity that an individual acquires when small amount of immunity to a disease is deliberately exposed to his body. Artificial active immunity is usually produced in the form of vaccinations. From the question, Nicholas has artificial active immunity because chicken pox vaccines were intentionally introduced to his body.

8 0
2 years ago
Why is mitosis such a critical part of the cell cycle?
Evgen [1.6K]

Answer:

Mitosis is a way of making more cells that are genetically the same as the parent cell. It plays an important part in the development of embryos, and it is important for the growth and development of our bodies as well. Mitosis produces new cells, and replaces cells that are old, lost or damaged.

Explanation:

5 0
3 years ago
Other questions:
  • Which compound is a reusable, complex protein that speeds up chemical reactions?
    5·2 answers
  • If brine shrimp eggs were transported on shorebirds feet from a hyper saline lake into a less salty one
    12·1 answer
  • A ________ diet restricts or eliminates foods that are hard to chew and swallow.
    7·1 answer
  • What is the answer to the first problem I am really stressed and struggling bio is not my subject
    13·1 answer
  • Descreva qual o caminho do impulso nervoso em uma pancada no joelho (dor) e o levantamento da perna
    8·1 answer
  • 17- Microorganisms which require 0-5.5 pH for the growth are:
    12·1 answer
  • What is the difference between an cell and a tissue?
    12·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Rocks created from intense heat or pressure deep inside Earth are called sedimentary metamorphosis igneous metamorphic
    5·2 answers
  • What is the answer please help yall
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!