1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zlopas [31]
3 years ago
7

Banana plants grown for food crops are the result of asexual reproduction. Does the genetic information of each plant come from

one or two parents? " record your evidence
"
Biology
1 answer:
Finger [1]3 years ago
3 0

asexual means to produce on it's own no parents Male or female needed

You might be interested in
Ailani age 3 is lactose intolerant and unable to drink milk or to eat dairy products. what nutrients is most likely deficient in
svetlana [45]
Calcium. Almonds, broccoli, oranges, kale
8 0
3 years ago
Read 2 more answers
State one effect the reintroduction of the wolf may have on the coyote population within the Adirondacks
Masteriza [31]

Answer:

Decrease in the population of coyote occurs after the reintroduction of the wolf within the Adirondacks  effect.

Explanation:

Wolves are the top predator in the ecosystem. They hate coyote and kill them and sometime eat them too. So the reintroduction of the wolf decreases the population of coyote by killing them directly and by consuming the prey and the coyote die due to hunger. Coyote feed on rabbit, snakes, deer, fruits and grasses so decrease in coyote population increases the availability of grasses and other animals for different animals.

5 0
3 years ago
(Earth/ Space Science)
lisabon 2012 [21]
C. Because they contain water ammonia, and methane
8 0
3 years ago
Read 2 more answers
PLEASE HELP ASAP<br> 95 POINTS!!!!
snow_lady [41]

Answer:

Girl bye

Explanation:do your work

Oh gagahahs and the hormymoneya re better because I am wasting your trip ma

7 0
2 years ago
Read 2 more answers
Please help me please
shusha [124]

Answer:

Okay just think about the question and what it's asking you. Don't overthink it. If you're still confused i'll put the answer in the comments

Explanation:

6 0
3 years ago
Other questions:
  • 15. Which of the following sources of pollution is currently considered the dominant source of carbon dioxide? (a) Cellular resp
    11·1 answer
  • Which of the following professionals could help a large city that needs a means of providing safe drinking water to all of its r
    13·1 answer
  • What type of mutation in nucleotide 4 would produce the same amino acid?
    6·1 answer
  • Which of the following could be considered a reliable source of scientific information
    11·1 answer
  • A plasma membrane and a cell wall
    5·1 answer
  • Attached earlobes are recessive to free earlobes. If two heterozygous individuals have a child, what is the probability of the c
    12·1 answer
  • How long will it take you to reach Fujairah from Dubai if you drive at the speed of 120 km/h. (Hint the distance between Dubai a
    6·1 answer
  • Which of the following best describes the dependent variable in an experiment?
    8·1 answer
  • In the stratosphere, ozone interacts with ultraviolet (UV) rays from the Sun. Ozone particles, once struck with UV rays, gain en
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!