1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mina [271]
3 years ago
13

Gluconeogenesis must use "bypass reactions" to circumvent three reactions in the glycolytic pathway that are highly exergonic an

d essentially irreversible. Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway?
Biology
1 answer:
Keith_Richards [23]3 years ago
7 0

Answer:1)Hexokinase

2)Phosphofructokinase (PFK)

3)Pyruvate kinase

Explanation:

The most important means of releasing energy from the glucose molecule is initiated by glycolysis.Glycolysis means splitting of the glucose molecule to form two molecules of pyruvic acid.The end products of glycolysis are then oxidized to provide energy.

Three reactions of glycolysis are highly exogernic,resulting in highly negative free energy changes that are irreversible and must be bypassed by different enzymes.These enzymes are hexokinase, Phosphofructokinase(PFK) and pyruvate kinase.

When the body's stores of carbohydrates decrease below normal,moderate quantities of glucose can be formed from amino acids and the glycerol portion of fat.This process is called gluconeogenesis. It is an important pathway that allows the body to store needed energy for the brain in the form if glucose.

You might be interested in
You've just read a research project titled: "Prolonged cell phone use causes brain tumors."
kvasek [131]

Answer:

<em>The correct option is B) number of patients with brain tumors</em>

Explanation:

In a scientific experiment, an independent variable is a variable which is being changed by the scientist or changes naturally. The effect of the independent variable is studied on another variable which is termed as the dependent variable. Hence, the dependent variable can be described as the variable which is under study in a scientific experiment.

In the following scenario, as the effect of prolonged cell phones is being tested on causing brain tumors hence, the number of patients with brain tumors will be the dependent variable.

4 0
3 years ago
Selena made a chart to group adaptations in birds based on their main functions. Which functions should Selena use as headings t
olya-2409 [2.1K]

Answer:

c

Explanation:

the answer is c

6 0
3 years ago
Question 5 please answer
otez555 [7]

Answer:

C.

Explanation:

I believe it would be C.

The tree is just starting to get  flowers, nut its already come out of the ground and so its not in the seed stage, and it does not have bark yet  so it cant be an adult tree

4 0
3 years ago
When using the forced-choice procedure in measuring odor detection thresholds, the experimenter should _____.​?
omeli [17]
When using  the  forced-choice  procedure in  measuring  odor  detection thresholds, the  experimenter  should separate  trial  by   about  30 second Forced  force  method  an  experimental    methods which  help to  obtain  threshold.For  a  single   interval and forced  choice method  there  they are  at least  three procedure  for  collecting  data.
5 0
3 years ago
In pea plants, the allele for inflated pod seed, I, is dominant over the allele for constricted pod seed, i. The Punnett square
zubka84 [21]

Answer:

<em>The offspring which carries the allele II will be homozygous dominant.</em>

Explanation:

A dominant trait can be described as a trait which masks the effect of a recessive trait. A recessive trait can be described as a trait which gets masked by the dominant trait.

A homozygous dominant trait occurs when both the alleles for the gen are dominant. A heterozygous dominant trait occurs when one allele is dominant and the other is recessive for the trait.  

Hence, a homozygous dominant trait will carry the alleles II.

8 0
3 years ago
Other questions:
  • How many chromosomes would be found in a deer mouse gametes
    8·2 answers
  • Researchers have crossed two true-breeding lines of peas that differ in the color of their leaf tissue: dark green vs pale green
    6·1 answer
  • Which of the following contradicts the "one-gene, one-enzyme hypothesis"?
    15·1 answer
  • Which of the following is not a reason why observed genetic distances between species do not reflect the actual distances?
    5·1 answer
  • True or False: Rainforests are home to many of the largest animals on Earth.
    10·1 answer
  • Will give brainliest! Please give me the correct answer! Thank you! (apex)
    12·1 answer
  • Electric charge drives this series of pumps and triggers known as eta reactions. What is the next effect of these reactions
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How would you describe the relationship between the two variables?
    13·1 answer
  • I will give you 20 points who every answers this one!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!