Answer:
Serine
Explanation:
The genetic code indicates the way by which the four bases of the messenger RNA (i.e., Adenine, Uracil, Guanine and Cytosine) are read in the ribosome to convert them into a protein. In this code, each codon is composed of three nucleotides that encode a single amino acid. Serine (S) residue can be synthesized by AGC (as in this case), AGU, UCA, UCC, UCG and UCU codons. The sequence above indicated (AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA) will be traduced in the following 5'-3' Frame: S-WAGAEKVR-, where the second codon is a stop codon (UGA).
Bending effect!! Whenever the orientation of the diffracting planes changes when the diffracting planes bend, the contrast changes.
Answer:
Control mechanisms
Explanation:
Organizational chart of any company will give details of different aspects of the company such as the major sub-units of the organization with the names of team leaders for different sub-units, it can also give you the span of control and the division of work within the company. However, the chart can't show you control mechanisms of different departments.