1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alborosie
3 years ago
5

Imagine that researchers publish a study that shows the following positive correlation: College students who spend more money on

new clothes tend to have more friends. Which of the following represents a plausible explanation for this correlation?a.Spending more money on new clothes makes college students more attractive to potential new friends.b.Having a lot of friends to go shopping with makes college students spend more money on new clothesc.Wealthy college students have more money to spend on new clothes and more money to do fun things with friends.d.All of these are plausible explanations for the correlation.
Biology
1 answer:
wariber [46]3 years ago
6 0

Answer:

Option (c).

Explanation:

Correlation may be defined as the statistical relationship used to explain the relation between two things. Two types of correlation are positive correlation and negative correlation.

The college students with more money and new clothes will help to make new friends as money can be used for more party and fun. The wealthy students has direct relation with new friends as they have more money to spend and enjoy with new friends.

Thus, the correct answer is option (c).

You might be interested in
...hugufuytg grdfhedhgrsfghserdh
Anni [7]
Uhhhhhhhhhhhhhhh yes.
3 0
4 years ago
Primary targets for insulin action include all of the following except
Cloud [144]

Answer:

renal glucose reabsorption

Explanation:

4 0
4 years ago
Explain why the following statement is false:
harina [27]

Explanation:

Tall, perennial grasses and herds of grazing herbivores are inhabitants of tropical and temperate biomes and not desert biomes.

Deserts do not support the growth of perennial grasses and a sustained herd population.

  • A desert is an arid landscape with very little to no rainfall through the years.
  • Plants needs water to manufacture their food and live.
  • Since this condition is absent, they cannot thrive in such biomes.
  • Grazing herbivores needs a lot of grasses to satisfy their foraging and ruminant nature.
  • Since grasses are lacking, they cannot survive.

learn more:

Deserts and steppes brainly.com/question/6685795

#learnwithBrainly

5 0
3 years ago
Cuantos codones codifican la proteiana valina
kicyunya [14]

Answer:

64 triplets or codons/64 tripletes o codones.

Explanation:

It is possible to order four different bases (A, T, C, G) in combinations of three into 64 triplets or codons.

Es posible ordenar cuatro bases diferentes (A, T, C, G) en combinaciones de tres en 64 tripletes o codones y solo como referencia futura use brainly.lat si planea hacer más preguntas en español porque ese es el dominio en español para este sitio web

6 0
3 years ago
Which are some characteristics of adaptive social behavior? Check all that apply.
nlexa [21]

Answer:

Adaptive behavior includes socially responsible and independent performance of daily activities. However, the specific activities and skills needed may differ from setting to setting. When a student is going to school, school and academic skills are adaptive.

Explanation:

5 0
3 years ago
Other questions:
  • Physicians who specialize in bariatrics treat which patient population?
    7·1 answer
  • Why are organelles surrounded by membranes?
    7·1 answer
  • Savannas typically have more trees than grasslands. Please select the best answer from the choices provided T F
    14·2 answers
  • What is the main difference between primary and secondary succession? <br> Plz help!
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • George's science class looked at living cells under a microscope. The students studied an organism that had many different kinds
    15·1 answer
  • The therory of gravity has
    5·1 answer
  • PLEASE HELP ME ASAP
    7·2 answers
  • How are acids and protons related? (1 point)
    8·1 answer
  • HELP ASAP NOW!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!