Solvents are dissolved in a solute to create a solution. Some examples are sugar solutions, where sugar is the solvent, water is the solute, and the solution is the sugar water that results, as long as the sugar is dissolved evenly in the water.
Hope this helped!
Symbiosis...fungi exchange his nutrients and minerals from soil with solar energy from the plant
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
<span>You should test a hypothesis by performing a controlled experiment.</span>
