1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiv31 [10]
4 years ago
8

According to endosymbiotic theory, mitochondria and chloroplasts contain a limited amount of genetic material and divide by_____

__________. Their DNA (deoxyribonucleic acid) is a circular loop like that of prokaryotes.
Biology
1 answer:
erica [24]4 years ago
4 0

Answer:

Splitting.

Explanation:

The endosymbiont theory explains the evolution of the organelles of eukaryotes by the ingestion of the materials of prokaryotes. Various evidence are available for the endosymbiont theory origin.

The mitochondria and chloroplast contains the similar RNA sequence and their genetic material is limited. The chloroplast and mitochondria divides by the process of splitting.

Thus, the answer is splitting.

You might be interested in
What is cell physiology<br>​
sleet_krkn [62]
Answer


Cell physiology is the biological study of the activities that take place in a cell to keep it alive. The term physiology refers to normal functions in a living organism. Animal cells, plant cells and microorganism cells show similarities in their functions even though they vary in structure.

Please mark me as brainliest
6 0
3 years ago
What is the monomer of a nucleic acid
Doss [256]

Answer:

Nucleotide

Explanation:

8 0
3 years ago
Read 2 more answers
What are the important features of the stratosphere?
Inessa [10]

Answer:

Climate: Precipitation levels are ecyremely loq in stratosphere and ita climate generally remain dry.

location: The stratosphere is situated between the troposphere.

temperature : Temperature in stratosphere with altitude to weather online.

presence of ozone:

Explanation:

Hope this helped Mark BRAINLIEST!!

5 0
4 years ago
What is the independent variable and dependent variable in a Cartesian diver?
Delvig [45]
The independent variable is whatever you're changing 
5 0
3 years ago
Under normal circumstances, a zygote has ____ pairs of chromosomes
insens350 [35]
46 for humans.
That’s 23 chromosomes from each parent.
8 0
3 years ago
Other questions:
  • The arrows in the chart above represent the movement of carbon between four reservoirs: the ocean, plants, fossil fuels, and the
    13·1 answer
  • The most common phenotype or allele for a gene in a population is referred to as
    13·1 answer
  • _______ are cell fragments
    13·2 answers
  • How many elements above KMnCl2K?
    6·2 answers
  • Drug cravings become heightened at when?
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • NA is made of nucleotides which are composed of A. a phosphate group, a sugar group and a nitrogenous base. B. a sugar group, an
    9·2 answers
  • The mammal pictured below is a silvery mole rat.
    15·2 answers
  • A population of birds contains 16 animals with red tail feathers and 34 animals with blue tail feathers. Blue tail feathers are
    7·1 answer
  • the stable microbes that inhabit the human body on a permanent or long-term basis, and generally do not cause disease, are refer
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!