1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
My name is Ann [436]
2 years ago
6

What does "200 ft." mean to a driver when we are talking about: A horn? A rear-view mirror?

Law
1 answer:
gulaghasi [49]2 years ago
6 0

Answer:

A rear-view mirror

Explanation:

You can see a certain distance from the mirror but with a horn there is no distance required

You might be interested in
Which of the following statements about alcohol consumption is CORRECT?
Bad White [126]

Answer: the answer is A i think

Explanation:

8 0
2 years ago
Read 2 more answers
Why do governments supply public goods and services, instead
Slav-nsk [51]

Everyone benefits from most public goods and services, so

everyone pays for them through their taxes.

<u>Explanation:</u>

Every citizen of a country uses public goods and services for their own use and they also pay tax to the government. Public goods and services are necessities like highways,water,police and others which are provided by the government.

There will not be much corruption in the country if people pays their tax properly. The government can earn major source of income through public goods and services.

5 0
3 years ago
What are the various clues that flames and smoke can offer the investigator in the arson investigation
lesantik [10]

Answer:

if they're warm or cold burns/embers

Explanation:

4 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
If your car is a manual shift, you should put it in gear when you park it to secure the car from rolling away
dezoksy [38]

The answer to your question should be True if you are leaving the car in 1st gear or in reverse because first and reverse provide the most resistance if the parking brake slips

7 0
3 years ago
Other questions:
  • A state's legislative branch?
    9·1 answer
  • In the U.S.,The South Carolina state constitution is the supreme law of the land?
    11·1 answer
  • If you need to censor a woman's nipples but you DON'T need to censor a man's nipples, could you IN THEORY censor a woman's nippl
    15·2 answers
  • Imagine the decade around the American Revolution when there was no unified legal system. Describe what you think
    9·1 answer
  • When policymakers are considering a particular action, they can use consumer surplus as a(n) A. objective measure of the benefit
    15·1 answer
  • What does the Eighth Amendment address?
    7·2 answers
  • Why is documentation important at a crime scene?
    6·1 answer
  • Which of the following is not a basic concept of democracy?
    9·1 answer
  • Is the Senate in Canada democratic? Why or why not? Explain your answer.
    8·1 answer
  • Which amendments limit the power of the federal government.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!