The temperature and blood pressure of the patient drops.
The lining of the heart is the pericardium.
When the nurse gives you a shot, the Vaccine release white blood cells that fights flu viruses, you can stay happy and healthy!
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The disorder where the grandfather and the grandchild are affected is related with the X chromosome and is called Sex linked or X linked disorder.
<h3><u>Explanation:</u></h3>
All the sex linked disorders are recessive in character i.e the normal allele is dominant over the mutated allele. In females, there are 2 X chromosomes, so the mutated allele is only expressed when there are both the mutated alleles, else its masked by the dominant normal allele. But in males, there's only one X chromosome, so if a mutated allele is present, it's readily expressed.
If the Grandfather is diseased, then he must have that mutated allele in X chromosome. Through reproduction, its received by the mother, but she is normal because the other allele received from grandmother was normal. But mother has one of the X chromosomes with mutated allele, which is received by the grandson who again becomes diseased.
So the disorder must be X linked disorder