What is a potential negative consequence of using genetically engineered medicine

Biology

2 answers:

arsen [322]3 years ago

8 0

gene markers resistant to antibiotics can lead to a increased risk in humans developing a resistance to an antibiotic.

Aleonysh [2.5K]3 years ago

4 0

Answer:

The genetically engineered medicines could lead to an unforeseen threat to the environment, that is, the biggest challenge is the capriciousness of the genetically engineered species. For example, a modified vaccine or virus may recombine its DNA with those of the naturally occurring species. The outcomes could have random features and may result in a threat of health hazards like antibiotic resistance or epidemics.

You might be interested in

What are the skeletal difference between a biped and a quadruped?

Allushta [10]

To see the difference between <span>biped and a quadruped,</span> let's compare the skeletons of the man (biped) and the horse (quadruped):

*The man has the bigger pelvis: he has to bear the weight of the body.*The scapula is smaller.*The bones of the hind leg bigger.*The forearms more mobile.*The man has the spine that attaches under the skull.*And the tail that has completely regressed.
the man has adapted to standing and biped (he walks on 2 feet): his hind legs are reinforced.

8 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein