"Kidneys are often compared to filters because they cleanse unwanted waste from both frogs and humans" is TRUE.
Answer: Option A
<u>Explanation:
</u>
Frogs also have the excretory system with two kidneys and similar to mammals. Its function is to eliminate the nitrogen product from the blood. Frogs make large volumes of dilute urine to wipe out harmful products from the tubules of the kidneys.
Tadpoles and aquatic frogs excrete the nitrogen as ammonia, but most terrestrial adults excrete it mostly as urea which is less threatening substance. A few tree frog species with little water access excrete the still less harmful uric acid.
CHON is a mnemonic acronym for the four most common elements in living organisms: carbon, hydrogen, oxygen, and nitrogen.
Hope this helps
The common characteristic of those two organisms is hard spherical shells (exoskeleton).
Foraminiferans are single cell marine eukaryotes divided into granular endoplasm and transparent ectoplasm. Foraminiferans are enveloped with tests, hard shells, usually composed of calcium carbonate (sometimes from organic compounds or silica).
Coccolithophore is a unicellular, eukaryotic alga with special calcium carbonate plates (or scales) of uncertain function (coccoliths). Each unicellular alga is enclosed in its own collection of coccoliths, the which make up its exoskeleton- coccosphere.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The law of conservation of mass states that the mass will stay constant given a chemical reaction because no atoms were created or destroyed. This being said, an example can include water evaporating in a clear bottle outside on a hot day ( the mass of the bottle will stay the same, but the liquid water evaporated into gaseous water).
