1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
5

Which product is directly obtained from water

Biology
1 answer:
Olegator [25]3 years ago
3 0

Ice is one of the many products that can be derived from water. it is just only in solid or ice form, after going through a physical change.

You might be interested in
Explain what asexual reproduction is, using a spider plant as an example.
kupik [55]
Answer:

Asexual reproduction is a type of reproduction that doesn’t involve gametes fusing or the change in the number of chromosomes. A spider plant is the perfect example of asexual reproduction, but when it comes to plants like that, it’s referred to a type of asexual reproduction called vegetative propagation.
7 0
3 years ago
Read 2 more answers
Genetic modification of organisms in aquafarming
densk [106]
The answer would be B
6 0
3 years ago
Which term describes the action of lions and hyenas fighting for the right to eat a dead gazelle?
MAVERICK [17]

<u>C. Interspecific competition</u> in ecology, is a form of competition in which individuals of different species compete for the same resources in an ecosystem (e.g. food or living space). This can be contrasted with interspecific cooperation, a type of symbiosis.

4 0
3 years ago
Help pls thanks omg !!!
poizon [28]

Answer:

3rd

Explanation:

3 0
2 years ago
What is the thick, old crust of Earth known as?
Vikki [24]
The answer is lithosphere.
5 0
2 years ago
Read 2 more answers
Other questions:
  • What must a cell do as it prepares to divide?
    8·1 answer
  • What is the difference between xylem and phloem tissue?<br> Worth 20 points
    15·1 answer
  • The festival site is the shoreline. What kind of complement is the word in bold? Predicate nominative objective complement direc
    7·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What were the earliest land plants
    11·2 answers
  • I need help on this answer
    10·2 answers
  • How does snake venom kill prey? How is venom toxicity measured?
    12·1 answer
  • What is a codon?
    9·2 answers
  • What happens when we decrease the height of an inclined plane?
    5·1 answer
  • 2.2 Landforms at Plate Boundaries
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!