1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Trava [24]
3 years ago
15

An object will absorb all colors of light except for the color that it appears to be.

Biology
2 answers:
Mumz [18]3 years ago
8 0
Yes, for example purple object absorbs all colors but its own.
evablogger [386]3 years ago
6 0
A white object<span> reflects </span>all<span> the wavelengths of visible </span>light<span> and </span>appears<span> white.</span>
You might be interested in
I need help with this please , I’ll mark you as a brainliest
Serjik [45]
If I eat candy then I will gain weight
If I shave my beard then it will grow back darker

With this you should be able to solve the rest :)
6 0
3 years ago
Arrange these structures in order of lower level of organization to upper level and write the level against each structure. neur
Dominik [7]

Answer:

electron, carbon, protein, mitochondria, neurons, mass of neuron, nervous system, brain, man

3 0
3 years ago
What do you think about the human and his structure how it's made all the human structure​
Licemer1 [7]

Answer:

its a thousand of generation evolution i think as of darwins law of evolution

4 0
3 years ago
Read 2 more answers
How do some protozoans respond to adverse environmental conditions ?
blsea [12.9K]
<span>"they form a cyst: a hard covering is formed around the protozoan and metabolic rate is slowed"</span>
8 0
3 years ago
Need help ASAP please help quickly??????
inessss [21]
The answer is coal, C.
It takes a long time to regenerate, therefore it is labelled as non renewable energy.
7 0
4 years ago
Other questions:
  • Before starting a lab you should _____. Select all that apply.
    8·2 answers
  • Which one of these algae used to prepare a medium for bacterial culture
    13·1 answer
  • What trace mineral is essential to sperm production and taste perception, and assists in immune function?
    5·1 answer
  • During the process of cellular respiration, energy is released from
    13·2 answers
  • what is the best synonym for hormone A. Bodily organ B. bodily tissue C. Blood cell D. Chemical Messenger
    5·2 answers
  • what are the similarities and differences between facilitated diffusion and active transport by a protein pump
    9·1 answer
  • The reason for the dramatic decline in the number in the number of measles cases from the 1960’s to 2010 in the United States wa
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How are blue and red litmus papers alike?
    8·2 answers
  • Cuales son 3 biomoleculas organicas que tenga el oxigeno?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!