1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
2 years ago
13

If star A is farther from Earth than star B, but both stars have the same absolute magnitude, what is true about their apparent

magnitude?
Apparent magnitude is not related to distance.
Star B has the greater apparent magnitude.
Star A has the greater apparent magnitude.
Both stars have the same apparent magnitude.
Biology
2 answers:
Sergio039 [100]2 years ago
8 0
<span>If star A is farther from Earth than star B, but both stars have the same absolute magnitude, the option which is true about their apparent magnitude is that star B has the greater apparent magnitude.
Apparent magnitude refers to the magnitude of an object in space as it is actually measured from the earth, whereas absolute magnitude refers to the star's brightness. 
</span>
Andreas93 [3]2 years ago
6 0
The B star would have a larger apparent magnitude
You might be interested in
What is true of carbon atoms? (2 points)
Rudiy27
By process of elimination you can find the right answer. We know for a fact that carbon is found in all living organisms. That is why we talk about carbon based life forms. So the first statement cannot be true. You can figure out how many Valence electrons an element has by looking at the group number. The group number of carbon is 4 so the 2nd statement cannot be true. We know that carbon does bond with other elements because it is not a noble gas and therefore must be able to form compounds.
This means the answer must be they can form up to four covalent bonds
6 0
3 years ago
10 branches of science first is definition of science
creativ13 [48]

Answer:

ham Bhan k Uthai xeya ta hamra Garmin lagai xa kathi la Kani k bara ma Pharo thanda lagai xai

7 0
1 year ago
The small hair like structures found all over a cell are called what?
vitfil [10]

ITS FLAGELLA THEY ARE FOUND IN ALL 3 KINGDOMS OF CELLS

6 0
3 years ago
Read 2 more answers
The karyotype for trisomy 21 illustrates an example of a genetic mutation caused by A) insertion. B) inversion. C) crossing over
Katyanochek1 [597]

Trisomy 21, as illustrated by the karyotype, is caused by nondisjunction. This occurs when chromosomes do not separate properly during meiosis.

Answer is D) nondisjunction

7 0
3 years ago
Read 2 more answers
The argument that each individual member of a species transforms itself to meet the challenges of a changed environment through
svlad2 [7]

Answer:

Jean Baptiste de Lamarck

Explanation:

i found this online

8 0
2 years ago
Other questions:
  • The term "aerobic" means "with ____
    15·1 answer
  • What are the weather events related to a stationary front?
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A species of rose was studied in Florida and was found to have the following distribution in petal color alleles: 70 for the red
    13·1 answer
  • In the human body, fibrinogen is necessary for sealing cuts and stopping the loss of blood. Since fibrinogen is made of chains o
    14·1 answer
  • How is your community like the human body, give two examples
    11·2 answers
  • The water, carbon and nitrogen cycles are examples of what type of cycle?
    7·1 answer
  • DNA is responsible for making a cell¨s what?
    9·2 answers
  • When a scientist uses radiometric dating to determine the age of a rock specimen, would he use a radioactive element with a shor
    8·1 answer
  • Which of the following is an example of the endocrine System maintaining homeostasis?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!