1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dezoksy [38]
3 years ago
9

30. One cause of muscle soreness is

Biology
2 answers:
xenn [34]3 years ago
4 0

Answer:

c. lactic acid fermentation

Explanation:

If we did alcoholic fermentation, working out would make us feel drunk, not sore. This is only done by yeasts (a type of fungus) and bacteria. Glycolysis is simply an anaerobic process that occurs with fermentation and also regular aerobic respiration. It doesn't cause any soreness on its own. The Krebs cycle is the second major part to cellular respiration; it produces 6 NADH's, 2 FADH2's, 4 CO2's and 2 ATP; it's not involved in creating any soreness, as cell respiration does not create soreness. That leaves lactic acid fermentation, which we, bacteria, yeasts, and other organisms do. This is what we do when we run out of ample oxygen while doing some strenuous activity. Glycolysis is done with it. Glycolysis, however, relies on NAD+ to create ATP we need to maintain the same level of activity, lactic acid is produced as it accepts the 2 electrons and [H+] NAD+  should accept.

balu736 [363]3 years ago
3 0
Lactic acid. simple as that.
You might be interested in
If you were to start at the base of a mountain and climb it all the way to the top, how would the climate change?
miv72 [106K]

Answer:

c

Cause at the bottom it is cold and up top is warmer

3 0
3 years ago
Read 2 more answers
Deposition of plaques in the walls of the arteries results in ______
Charra [1.4K]
Hardening of the arteries results in atherosclerosis and deposition of plaques in the walls of the arteries results in <span>atherosclerosis</span>.

Hope this helps !

Photon
4 0
3 years ago
Read 2 more answers
Answer 1-4 and explain
tatuchka [14]
1. is (A) because mouse and deer are not in the same ecosystem.
2.is (D) because both antelope and domestic cattle do not affect each other.
3. is (B) because food is important factor.
4.is (C) because without home it is not possible to adapt in an ecosystem.
4 0
4 years ago
Why did Gregor Mendel remove the sex parts from two different groups of plants?
sashaice [31]

Answer:

Mendel was interested in the offspring of two different parent plants, so he had to prevent self-pollination. He removed the anthers from the flowers of some of the plants in his experiments. ... The offspring that result from such a cross are called hybrids.

Explanation:boom

5 0
3 years ago
Cystic fibrosis is a devastating illness that affects the lungs, pancreas, and intestines.In 1989, researchers discovered that t
Natalka [10]

Answer:

There is no cure for cystic fibrosis, but treatment can ease symptoms and reduce complications.

Explanation:

1). For those with cystic fibrosis who have certain gene mutations, doctors may recommend a newer medication called ivacaftor. This medication may improve lung function and weight, increases the activity of Cystic fibrosis transmembrane conductance regulator (CFTR)protein and reduce the amount of salt in sweat. It has been approved by the Food and Drug Administration for people with cystic fibrosis who are age 6 and older. The dose depends on your weight and age.

2). For people with a certain gene mutation who are age 12 and older, another drug is available that combines ivacaftor with a medication called lumacaftor. This drug is called orkambi.

The use of Orkambi may improve lung function and reduce the risk of exacerbations.

I hope you're clear on this Daxxy

3 0
3 years ago
Other questions:
  • What are three solution to the environmental of mesopotamia
    6·1 answer
  • You are the registered nurse performing a health assessment on a newborn infant. from the functional health pattern portion of t
    10·1 answer
  • Beth learned in her science class that white blood cells in the human body capture harmful material by engulfing them. Then they
    5·2 answers
  • Which of the following is called Energy of activation or Eact? The energy released during an exergonic reaction The additional e
    7·1 answer
  • What is Carbon Cycle?​
    13·1 answer
  • What might explain why light travels in a straight line?
    9·2 answers
  • What is the simplest form of cellular organization in the multicellular organism
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 3
    5·1 answer
  • All cells regardless of type build themselves, build tissues, and transport, and make products.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!