1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
2 years ago
11

a species that adapts will be more likely to A.) become extinct B.) mutate C.) survive D.) live a short life

Biology
2 answers:
N76 [4]2 years ago
5 0

The answer is C: Survive. therefore making the sentence: A species that adapts will be more likely to survive.

Hope this helps

klemol [59]2 years ago
4 0
C,when an animal adapts it changes itself or its behavior for the better of survival.
You might be interested in
List 3 big disadvanges of having a mechanical heart ​
motikmotik

Answer:

no feeling

not always working

infections

3 0
2 years ago
What kind of cells in the human eye perceive color?.
frutty [35]

Answer:

Cone cells help detect colors.

Explanation:

Light travels into the eye to the retina located on the back of the eye. The retina is covered with millions of light sensitive cells called rods and cones. When these cells detect light, they send signals to the brain. Cone cells help detect colors.

8 0
2 years ago
What would be a good name for a graph with this information?
adoni [48]

Answer:

a bar graph

Explanation:

8 0
3 years ago
Read 2 more answers
The amphiarthrotic articulation that allows limited movement between the two pubic bones is the __________.
sertanlavr [38]

Answer: pubic symphysis

Explanation:

The amphiarthrosis is the joint which shows limited mobility. This joint is a kind of cartilaginous joint which unites the body of two vertebral bones.

The amphiarthrosis articulation can be seen at the pubic symphysis of the pelvis. This cartilaginous joint strongly anchors the pubic region of the right and left hip bones. This region exhibit restricted mobility. The strength of this region helps in the weight-bearing stability of the pelvis during pregnancy.

8 0
3 years ago
Prepare a pamphlet on the problem of population growth​
Goryan [66]

Answer:

problems of population growth are

  1. economic causes
  2. economic status
  3. Poverty status
  4. Occupational status
  5. Unemployment

Explanation:

1. Economic causes : the economy always affect the fertility rate of any country. parents in backward communities considered their children as sources of income in future. most of these parents think that producing more children is helpful addition to the workforce and a means to increase the agricultural production.Economic causes refers to those aspect of our life that affect the population size from economic point of view.

2. Economic status: number of children are more in agro based communities. economic status also increase the population.in agricultural countries like I was all the works are done manually so more level forces are working people are required. farmer think that if they have large family they will accomplish their works easily and they will not have to hire people. they will be able to save the unnecessary cost . In other words ,the polar parents give birth to many childrens. it helps to increase the population.

3. Poverty: Poverty is another important factor of population growth in every country.many people of their country are under the absolute poverty line.they think that the birth of a son is the prospect of income in the family and he will drive them away from the poverty-stricken life.earn more money to wipe out their poverty. similarly, many pop people are deprived of even basic needs. education becomes an additional need to them. Then, the same vicious circle of illiteracy binds them within the same boundary of inner ignorance and poverty. Therefore,poverty plays an important role to increase the population of any country.

<h2>Hope! it's Help You </h2><h3 /><h3 /><h3>I have just explained 3 of them</h3>
7 0
3 years ago
Other questions:
  • What is the definition of microorganism
    12·2 answers
  • a client receives blood work back showing high levels of lipoproteins and low levels of low density lipoproteins
    12·1 answer
  • Explain how the composition of the mantle is important to plate tectonics
    9·1 answer
  • For which reasons would a male peacock spread his tail feathers?
    11·1 answer
  • If you treated embryos with a Notch inhibitor how would this affect the specification of venous and arterial endothelial cells?
    14·1 answer
  • Question 2 of 5
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • If anyone sees this question can they help me out?
    8·1 answer
  • Explain how a change in the sequence of nucleotides in a strand of DNA might cause
    6·1 answer
  • glyphosate (brand name round-up) is the most utilized chemical in association with genetically modified crops. what does it do?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!