1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
3 years ago
5

What is the genetic of finger?​

Biology
2 answers:
bogdanovich [222]3 years ago
6 0

Explanation:

this is the answer hope it works

Arada [10]3 years ago
5 0
Brachydactyly is an inherited condition, which makes genetics the main cause. If you have shortened fingers or toes, other members of your family most likely also have the condition. It is an autosomal dominant condition, which means you only need one parent with the gene to inherit the condition.
You might be interested in
What is the correct order of biological organization from broadest to most specific
quester [9]

Answer:

This is just the order of taxonomic groupings.

Domain (Broadest)

Kingdom

Phylum

Class

Order

Family

Genus

Species (Most specific)

8 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
A geneticist crossed pure breeding black mice with pure breeding brown mice. All the 992 mice in the F1 generation had black coa
uysha [10]

Answer:

C. An approximately three-to-one ratio of black to brown coated mice in F2 is accounted for by the black allele being dominant over the brown allele

Explanation:

Assuming the black genotype is BB and the brown genotype is bb.

At F1:

                 BB   x   bb = All Bb (black)

At F2:

                  Bb   x   Bb = BB (black), 2Bb (Black), bb (brown)

Th ratio of black to brown is 3:1

961 black : 317 brown is approximately 3:1.

Hence, the correct option is C.

<em>An approximately three-to-one ratio of black to brown coated mice in F2 is accounted for by the black allele being dominant over the brown allele</em>

4 0
3 years ago
Most rocks are made of_________ minerals
nasty-shy [4]

Answer:

Scientists can distinguish more than 4,000 different minerals but many are very rare. About 200 minerals make up the bulk of most rocks. The feldspar mineral family is the most abundant. Quartz, calcite, and clay minerals are also common.

Explanation:

Here's what i found hope it helps

7 0
3 years ago
Read 2 more answers
How can the arrangement of furniture in a room influence an individual’s behavior?
Ira Lisetskai [31]
An individual's behavior can be influenced sociologically, psychologically and physiologically by the arrangement of an interior environment. Dependent on functionality, co-working space etc of the room, a person may require more or less privacy which is related directly to productivity, social balance, personal happiness and other problematic or positive behavioral encounters.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Climate change is having a great impact on the Arctic food web on land and on the ice. The animals most at risk from a warming p
    15·1 answer
  • Which of these is required for natural selection to occur?
    14·1 answer
  • In your own words, explain why a virus such as the rhinovirus, which relies on close contact to spread, might evolve to favor le
    15·2 answers
  • Question 5 unsaved adding a unit to move a susceptible group enough to prevent metabolism is known as
    6·1 answer
  • Pathway of sound from the time a sound is generated to the time our brain registers the sound
    7·1 answer
  • Does anyone know what this is asking :)? And give an example of what I am supposed to put? BRAINLIEST
    7·1 answer
  • Which of the following plants creates a chemical compound that kills herbivores that eat it?
    7·2 answers
  • Answer with anything, ill give you brainliest (no question)​
    15·1 answer
  • Which term best describes a spinal cord
    14·1 answer
  • 3.List the 3 strengths &amp; 3 Weaknesses of behaviorism.​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!