1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grin007 [14]
3 years ago
6

This flower is able to pollinate itself which statement must be true

Biology
1 answer:
Eva8 [605]3 years ago
5 0
Sunflower is the right answer
You might be interested in
What is an introduced species ( APEX question )
liubo4ka [24]

What is an introduced species ?

A. A species that is a poor predator

<u>B. A species that does not normally live in an area </u>

C. A species that has no permanent home

D. A species that increases biodiversity

3 0
3 years ago
Read 2 more answers
During a pet scan, a london cabby is asked to describe the route she would take a fare from the west end theater district to har
bezimeni [28]
The correct answer is "increased activity of the right hippocampal formation".
Hippocampus is a brain area which is part of the limbic system and is located below the cerebral cortex. Humans have two hippocampi, one in each side of the brain. Hippocampus is responsible for the formation of long-term memories, by participating in the consolidation of short-term to long-term memory. It also plays a very important role in spatial memory and orientation.
The task that this experienced cab-driver is asked to perform is related to spatial navigation and orientation abilities. The right hippocampus has been shown to participate in the formation of memory for locations in specific environments, while the left hippocampus has been shown to be involved in autobiographical and episodic memory. As a result, the PET scan will show an increased activity of the right hippocampus. 
8 0
3 years ago
Why do shorter females have more oestrogen than taller females?
Free_Kalibri [48]
Because high estrogen halts bone growth
7 0
3 years ago
in pea plants round seeds are dominant and wrinkled seeds are recessive. the cross rr x rr, what percentage of the offspring wil
In-s [12.5K]

Answer:

0%

Explanation:

Round = Dominant

Wrinkled = recessive

Recessive = r

Dominant = R

homozygous dominant = RR

homozygous recessive = rr

Heterozygous= Rr

Since both seeds are homozygous recessive (rr)

In your punnet square, one lower case r will go on the top and the left side

r r

r

r

Something like that.

Go across your four boxes and you will end up with;

rr, rr

rr, rr

In order for it to be round, at least one box would need to have to be a heterozygous(Rr) or be a homozygous dominant.

7 0
1 year ago
The main role of this system is to provide the gas exchange between the blood and the environment. Which body parts perform this
astraxan [27]

Answer:

A

Explanation:

8 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Pure chlorine is an example of a(n) _____.<br><br> element<br> compound<br> mixture<br> solution
    11·2 answers
  • Which is a natural process in which water, wind, or ice changes the shape of the Earth's crust?
    5·1 answer
  • azman disuruh oleh cikgu untuk memanaskan alkohol didalam sebuah tabung didih . apakah langkah langkah yang perlu diambil semasa
    7·1 answer
  • Animal behavior Essay
    9·1 answer
  • What is 1 example of a greenhouse gas PLZ HELP!!
    8·2 answers
  • Meristem cells _____ into xylem, phloem, and other specialized tissues.
    7·2 answers
  • Where does the oxygen used in cellular respiration end up
    10·1 answer
  • 1.A virus mutates, and therefore it has which of the following traits of living things?(1 point)
    13·1 answer
  • What are bacteria that can produce their own food without using the sun's energy called?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!