A salt or ester of phosphoric acid, containing PO43− or a related anion or a group such as —OPO(OH)2.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
The sites of replication.
Explanation:
Linear DNA is and advantage for bigger organisms because there can be many places where replication can occur, otherwise, in circular DNA replication can only happen in he ORI place, that is unique. This feature allows to replicate several genes in the same amount of time being more efficient in protein synthesis.
