1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
3 years ago
12

Which commodity is used most heavily in industrial economies steel plastic or wood

Biology
2 answers:
stira [4]3 years ago
4 0
Wood should be correct
wlad13 [49]3 years ago
4 0
Hello there.

Which commodity is used most heavily in industrial economies steel plastic or wood
Wood.
You might be interested in
Complete the analogy below.
posledela
<h2>The answer would be A.</h2>

When there are <em>multiple convection cells in each hemisphere</em>, something called <u>"The Coriolis effect"</u> happens. The defination is basically that the Earth rotates perpendicular to it's axis which is answer A.

Hope this helps!

I used it on my test and it was right.

4 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which phrase best describes the main function of the kidneys?
Rom4ik [11]
The answer is C the main function of the kidneys is <span>filtering wastes from the blood</span>
6 0
3 years ago
Read 2 more answers
How does dissolved oxygen levels in the water effects kelp?
Gre4nikov [31]

Answer:

As the temperature of the water goes up, the amount and spatial extent of the kelp goes down. These changes could result in dramatic habitat loss leading to reduced ecosystem productivity and the extinction of many invertebrate species.

Explanation:

Hope it helps :3

6 0
2 years ago
A client is admitted with systemic lupus erythematosus (sle). the laboratory report shows the presence of neutrophils and monocy
andrey2020 [161]
This is a type III hypersensitivity reaction mediated by immune complex deposits. Immune complexes are antigen-antibody (commonly IgG) complexes that are soluble and prone to deposition in multiple organs. Once immune complexes are deposited in an organ, neutrophils and macrophages will then attack the organ causing organ damage and eventually failure. Type III hypersensitivity reactions are characteristic in SLE and other autoimmune diseases such as rheumatoid arthritis, etc.

Other types are type I hypersensitivity which are mediated by mast cells and histamine with the involvement of IgE and this commonly happens in allergic reactions. Type II hypersensitivity is cytotoxic hypersensitivity wherein antibodies directly attack organs (not forming immune complexes). Type IV hypersensitivity (or cell-mediated toxicity) involves T-lymphocytes. This is a delayed type of hypersensitivity exemplified by reactions from <em>M. tuberculosis</em> bacilli in tuberculous disease.
6 0
3 years ago
Other questions:
  • Marvin blows up a balloon but lets go of it. The air inside is released and the balloon goes up into the air. What best describe
    6·1 answer
  • What type of bird is this
    11·1 answer
  • The proliferation of angiosperms is because they are __________.
    15·1 answer
  • The conversion of nitrogen gas to compounds useful to crops is called
    5·1 answer
  • Which algae family does kelp belong to?
    7·2 answers
  • How would you argue that viruses are living things?
    5·2 answers
  • Which type of reproduction produces offspring with more genetic variations?
    14·1 answer
  • Test due later help pls
    11·1 answer
  • Similarity between vestigial structures and homologous structures
    9·1 answer
  • Where is retinal found?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!