1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kodGreya [7K]
3 years ago
12

Explain why a specimen must be viewed under a compound light microscope?

Biology
2 answers:
Furkat [3]3 years ago
7 0

Answer:

Because it is very small.

Explanation:

Specimens observed by a compound microscope needs to be very thin, so that light can pass through them. If they were not slim enough for light to cross by them, they would not be apparent under a compound microscope.

zubka84 [21]3 years ago
6 0
Because that organism is really really small
You might be interested in
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Which is a function of root hairs? store food produced in the leaves protect the root from injury absorb water and nutrients tra
Liula [17]
Absorb water and nutrients
6 0
3 years ago
What is homo sapiens?
GrogVix [38]
The species that you and all other living human beings on this planet belong to isHomo sapiens. During a time of dramatic climate change 200,000 years ago, Homo sapiens evolved in Africa. Like other early humans that were living at this time, they gathered and hunted food, and evolved behaviors that helped them respond to the challenges of survival in unstable environments.
3 0
3 years ago
Protein breaks down into
amm1812

Answer:

amino acids

Explanation:

Proteins ingested in the diet are digested into amino acids or small peptides that can be absorbed by the intestine and transported in the blood.

3 0
3 years ago
Read 2 more answers
With what does the synthesis of a new strand of dna begin with
andrew11 [14]
Following the initiation of DNA replication, the first step is the synthesis of <span>a short RNA primer.</span>
8 0
3 years ago
Other questions:
  • Can you label the structures involved in the endosymbiotic origin of mitochondria and chloroplasts?
    5·1 answer
  • The burning of fossil fuels will have the greatest direct effect on the environment in which of the following ways?
    11·1 answer
  • 3 Earth Science questions-
    7·2 answers
  • When humans chose the traits they want in offspring it is called?
    7·1 answer
  • First person to answer correctly get brainliest!.......the heart is to____muscle as the stomach is to____
    9·2 answers
  • Who is Bill Nye the science guy?
    5·2 answers
  • Based on evidence of the Red Shift of stars and galaxies, scientist now know that
    10·2 answers
  • At what temperature does all molecular motion stop?
    8·1 answer
  • 9. The classification system groups organisms in progressively _______<br> categories.
    8·1 answer
  • What is osmoregulation​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!