1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delvig [45]
3 years ago
13

A special protein in your blood captures and carries oxygen. This protein is called what

Biology
1 answer:
Kamila [148]3 years ago
5 0
Hemoglobin is a special protein in the blood that captures and carries oxygen.
You might be interested in
What is the total amount of matter in an ecosystem doing
stepan [7]
<span>The flow of matter in an ecosystem is not like energy flow. Matter enters an ecosystem at any level and leaves at any level. So, its always flowing
</span>
6 0
3 years ago
Read 2 more answers
In what phase of mitosis do the chromosomes line up along the center of the cell?
d1i1m1o1n [39]

Answer:

metaphase

Explanation:

5 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
ANSWER FOR BRAINLIEST
PolarNik [594]
Crocodiles and birds I think
7 0
3 years ago
Brine shrimp live in salt water, but the level of salt in the water where they reside can differ dramatically from day to day or
Naily [24]

Answer:

The correct answer is "excretes; hypotonic; absorbs, hypertonic".

Explanation:

Cell's homeostasis is only conserved in an isotonic solution, since cells that are in an hypertonic solution (high salt concentration) tend to loss water, and in hypotonic solution (low salt concentration) tend to absorb water. Brine shrimp lives in waters that are both, hypertonic and hypotonic and has adapted to overcome this issue by excreting and absorbing salt across its gills. In very high salt concentrations, a brine shrimp "excretes" salt across its gills and maintains an internal salt concentration that is "hypotonic" relative to the water where it lives. In lower salt concentrations, a brine shrimp "absorbs" salt water across its gills and maintains an internal salt concentration that is "hypertonic" relative to the water where it lives.

8 0
3 years ago
Other questions:
  • Which of the following statements is true about moss and fern reproduction?
    9·1 answer
  • What is the control variable in the experiment
    12·1 answer
  • Substrate-level phosphorylation directly generates ATP during a chemical reaction. As a single molecule of glucose is completely
    12·1 answer
  • Science please help!! Due in 1 mins
    14·2 answers
  • During cellular respiration, energy comes from breaking the bonds of water of which sugar? lactose sucrose fructose glucose
    5·2 answers
  • The cell is undergoing meiosis Il. Which stage of Meiosis Il is the cell in?
    10·1 answer
  • What is a substance that cannot be broken down into any other 1 1 po
    9·1 answer
  • Someone plz help me
    13·1 answer
  • Sucrose (table sugar) is a disaccharide of glucose and fructose. Fructose (one of the products) is much sweeter than sucrose (th
    6·1 answer
  • Which volcano location erupted with pyroclastic flows resulting in ash cloud
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!