The cells of SA node acts as the heart's peacemaker which establishes the pace for cardiac activity.
Sinoatrial node is also called sinus node.
SA node is termed as a group of cells which are located in the wall of the right atrium of the heart. Cells have the ability to produce electrical impulse. It travels to the heart via electrical conduction system which causes it to contract.
It produces action potential and also sets the rhythm of the heart.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Answer:
the answer is D. None of the above.
It would be harmed by chemicals in the environment. ... In binary fission, the two new cells that are formed are susceptible to the same antibiotic.
The correct answer is bpa in bottles affects particular glands.
An endocrine disruptor is a chemical which at certain doses can disrupt the normal endocrine function of the organism. The effects of an endocrine disruptor can be quite severe, from birth deficits and cancerous tumours to developmental disorders.
One of the most commonly detected chemicals in the human body is bisphenol A (BPA), a material used in the production of plastics. It is considered an exoestrogen, meaning that it possesses hormone- and estrogen-like properties. These properties affect specific glands of the human body causing reproductive and neurological problems, obesity, diabetes and some types of cancer.
Feedback from estrogen is a mechanism that the human body uses to control the FSH release from the gonads. This is not considered an endocrine disruptor since it is a natural mechanism. In addition, iodine is a chemical element essential for the synthesis of thyroid hormones. Any lack of it is not considered an endocrine disruptor. Finally, calcitonin is a hormone produced in humans by specific cells of the thyroid gland and it is not considered an endocrine disruptor.
