1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hitman42 [59]
3 years ago
12

Please help me ASAP. I need it to be done in less then five mins

Biology
2 answers:
Ghella [55]3 years ago
7 0

Answer:E

Explanation: 1. because sharks dont eat mice or lions. 2. EEEEEEEEE. 3. Imma GOD

Iteru [2.4K]3 years ago
3 0
Sharks definitely





sharjs
You might be interested in
Which type of protein in the plasma membrane has carbohydrate attached to it so that cells can be distinguished from one another
sashaice [31]
<span>cell-recognition protein</span>
6 0
3 years ago
This model shows a human embryo. What can you determine about its development from the model?
sasho [114]

Answer:

It has a postanal tail.

It has pharyngeal arches.

5 0
3 years ago
Co2 in the atmosphere is absorbed by ________ and converted into biomass. the ozone layer photosynthetic organisms large land ma
Maslowich
The answer is heat . You're welcome
3 0
3 years ago
What is one job of RNA?
ololo11 [35]
I think it's C., carrying genetic information.
4 0
3 years ago
Read 2 more answers
if a 1st quarter moon phase appears on the night of july 4th, what is the approximate date in which a 3rd quarter moon will appe
lilavasa [31]

Answer:

18th of July

Explanation:

Given that each quarter of a moon phase occurs after seven days, hence, if a 1st quarter moon phase appears on the night of July 4th, the approximate date on which a 3rd quarter moon will appear in the night sky on the 18th of July.

This is because, after the first quarter of a moon phase of July 4th, the second quarter of a moon phase will occur on the 11th of July, while the third quarter will occur on the 18th of July.

3 0
3 years ago
Other questions:
  • I swear i litterly have minutes to get this done pllzz anyone out their answer promise to give brainlist plzzzzzzzzzzzzz i reall
    15·2 answers
  • Where is the greatest concentration of nitrogen? which organisms make it usable?
    9·1 answer
  • Kksslmsmsmslwls<br> S<br> no te voy hacer u
    10·2 answers
  • students commonly confuse Saccharomyces cerevisiae and staphylococcus aureus when viewed on a microscope slide how could you mic
    14·1 answer
  • What role does skin play in the excretory system?
    14·1 answer
  • Describe the features that allow you to distinguish between plant cells and animal cells.
    7·2 answers
  • An investigator wants to understand whether a newly found membrane protein is involved in membrane transport of a certain partic
    13·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • would a trait that has only two distinct phenotypes more likely be a single-gene trait or a polygenetic trait? How do you know?
    11·1 answer
  • If a man with O blood marries a woman with AB blood, what is the chance that their child will be O blood? Please show a punnet s
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!