1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
2 years ago
9

Why is the citric acid cycle a cyclic pathway rather than a linear pathway?

Biology
1 answer:
Rama09 [41]2 years ago
3 0

The given question is incomplete as the four possible explanations or options are not provided, however, the correct options are as follows:

A) More ATP is produced per CO2 released in cyclic processes than in linear processes.

B) It is easier to remove electrons and produce CO2 from compounds with three or more carbon atoms than from a two-carbon compound such as acetyl CoA.

C) Redox reactions that simultaneously produce CO2 and NADH occur only in cyclic processes.

D) Cyclic processes, such as the citric acid cycle, require a different mechanism of ATP synthesis than linear processes, such as glycolysis.

Answer:

The correct answer would be - option B

Explanation:

Circular pathways or the cycles are able to carry out two or more than two entry and exit points for the substrate enzyme and products, So it is well suited for amphibolic reactions.

In a linear pathway, one reaction with particular substrate or reactants  and result in products through the pathway completes the pathway, and the second reaction would be an independent event.

In citric acid cycle It is easier to eliminate electrons and gain carbon dioxide from compounds with 3 carbon or more carbon atoms than from a two-carbon compound such as acetyl CoA. pyruvate is 3 C compound while acetyl CoA is two carbon.

Thus, the correct answer is - option B

You might be interested in
Diabetes is often suspected when glocose shows up in urine tests. Use the model to explain how glucose could be present in urine
DENIUS [597]

Answer:

Because the body would not properly digest sugars.

Explanation:

6 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Where does respiration take place?​
nordsb [41]

Answer: respiratory system

Explanation:

The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide

4 0
2 years ago
Read 2 more answers
ASSETS
bearhunter [10]

Answer:

when you make additional information you need to come up with a correct answer

8 0
3 years ago
Cognition is best described as: a) a reversible and normal suspension of consciousness. b) recognizing, processing, planning, an
Burka [1]

Answer:

Recognizing, processing, planning, and responding to stimuli.

Explanation:

Cognition may be defined as the process or mental action that helps in acquiring knowledge and understanding something. This might encompasses  the intellectual functions as well.

The main aim of cognition is recognition or to recognize some thing. After recognizing the individual must have the ability to process the information and must have proper plan to use this information. The individual then can respond to that particular stimuli after the proper cognition.

Thus, the correct answer is option (b).

4 0
2 years ago
Other questions:
  • Why do most stars not necessarily die in the time we would normally expect them to?
    13·1 answer
  • Explain how our respiratory and circulatory systems relate to cellular respiration and ATP.
    13·1 answer
  • One astronomical unit (AU) averages about.
    13·2 answers
  • What is an antonym for organelle
    15·2 answers
  • Certain microbes, foreign tissues and some cancerous cells can cause immune response in human body because all three contain
    6·1 answer
  • Help plss !! really need help
    9·1 answer
  • Independent activity
    15·1 answer
  • 1. If a DNA strand has 33 % cytosine what percent will be adenine?
    12·1 answer
  • What is the meaning of the term latitudinal gradient?
    5·1 answer
  • Which of the following biomes contains the least amount of diversity?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!