1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eddi Din [679]
3 years ago
13

Which observation about the Rocky Mountains and the Appalachian Mountains would support the claim that exposure of weathering an

d erosion overtime can change land forms?
A: The Appalachian Mountains are found in the eastern US and the Rocky Mountains are found near the west coast


B: The shorter and more rounded the Appalachian Mountains are more than four times older than the taller and more jagged Rocky Mountains


C: The length of the Appalachian chain is about 2,400 kilometers and the Rocky Mountain chain is about twice as long


D: The Appalachian Mountains are composed mostly of sedimentary rocks while the Rocky Mountains also contain other rock types
Biology
1 answer:
Ostrovityanka [42]3 years ago
3 0

Answer:

B: The shorter and more rounded the Appalachian Mountains are more than four times older than the taller and more jagged Rocky Mountains

Explanation:

  • The Appalachian mountains form a system of mountains in eastern North America and are older than rocky mountains as they were formed 480 million years ago and are similar to those of the alps. They form a barrier to the east to the west.
  • They extend to southeast Canada and form zones of 300 miles wide. They form the mountain ranges surrounding hills and the dissected plateaus forming at an elevation of 6,684 meters from the sea level. <u>Whereas the rocky mountains are younger and have an elevation of 4,401 meters.</u>
You might be interested in
The organism P matariae lives in red blood cells, causing the host organism to experience high fevers and chills what
MissTica

Answer:

C

Explanation:

Parasitism is a relationship between two different organisms where the parasite harms the host.

3 0
3 years ago
Eating chocolate may cause pimples hypothesis ​
viktelen [127]

Answer:

Yes...

Explanation:

Hypothesis is a proposed explanation made by reasoning without assuming what the truth is..

From the question;

Formal hypothesis: Eating chocolate may cause pimples because chocolate will result to an increment in the amount of oil in the skin and this will result in pimples.

2. Salt in water can affect plants growth.

Formal hypothesis: plants grow beside the ocean will grow slower because the salt present in the soil will destroy the root of plants.

8 0
3 years ago
Is biomass in the rainforest an energy source or energy sink
Lera25 [3.4K]

Answer:

Is biomass in the rainforest an energy source or energy sink

Explanation:

5 0
3 years ago
The formation of the major Hawaiian Islands began approximately 28 million years ago. These islands have formed as the Pacific I
pashok25 [27]

Answer:

Hawai'i, that honeymoon destination known for stunning sunsets, has a dark secret—it’s a geologically violent place. That’s because the Hawaiian Islands were born from volcanic activity. In fact, that volcanism can still be observed today in Hawai'i.

The six largest Hawaiian Islands—the Big Island, Maui, Lanai, Molokai, Oahu, and Kauai—form a chain of islands running to the northwest. The islands appear in this pattern for a specific reason: They were formed one after the other as a tectonic plate, the Pacific Plate, slid over a plume of magma—molten rock—puncturing Earth’s crust. These magma plumes aren’t small—they can extend hundreds of kilometers below Earth’s surface.

This upwelling of molten rock, known as a “hot spot,” creates volcanoes that spew out lava (magma that reaches Earth’s surface). The lava then cools and hardens to create new land. The Hawaiian Islands were literally created from lots of volcanoes—they’re a trail of volcanic eruptions.

Hot-spot volcanism can occur in the middle of tectonic plates. That’s unlike traditional volcanism, which takes place at plate boundaries. One explanation that scientists have proposed for hot-spot volcanism is that it occurs near unusually hot parts of Earth’s mantle, the layer of the planet below the crust.

In the case of the Hawaiian Islands, the Pacific Plate is continually moving to the northwest over the Hawaiian hot spot. This movement caused the Hawaiian chain of islands to form. The Pacific Plate is just one of the Earth’s roughly 20 tectonic plates, which are constantly in motion and are responsible for events like earthquakes.

There are many landforms around the Hawaiian Islands that formed from the same volcanic hot spot. Scientists believe this hot spot has been expelling lava for roughly 70 million years.

Many of these landforms created by volcanoes are still submerged. Also submerged are the peaks of the Emperor Seamount to the northwest of Hawai'i, which is part of the same chain of volcanic formations. A seamount is a submarine mountain. The Emperor Seamount extends for more than 6,000 kilometers (3,728 miles) from Hawai'i up to the Aleutian Trench in Alaska. In total, more than 750,000 cubic kilometers (180,000 cubic miles) of lava erupted to form all of the landforms in the Hawaiian–Emperor chain. That’s enough to cover the entire state of California in a layer of lava more than one kilometer (0.62 mile) thick.

Volcanic activity is still occurring on the southern shore of the Big Island, the youngest of the Hawaiian Islands. In 2018, the Kilauea volcano erupted spectacularly and inundated over 30 square kilometers (30.5 square miles) of the Big Island with lava. The layer of lava was up to 24 meters (79 feet) thick in places—taller than a six-story building. Thousands of earthquakes accompanied the eruptions, and nearby residents and staff at the United States Geological Survey’s Hawaiian Volcano Observatory near Kilauea were forced to evacuate.

Kilauea isn’t the only volcano on the Big Island. There are also Kohala, Mauna Kea, Hualalai, and Mauna Loa. Of these four volcanoes, only Hualalai and Mauna Loa are active. Mauna Kea, a dormant volcano on the Big Island, is in fact the tallest mountain in the world measured from its base to its top. It’s over 10,000 meters (32,800 feet) tall, significantly taller than Mt. Everest. But nearly 6,000 meters (19,700 feet) of its height is below the sea, so we only see about 4,000 meters (13,000 feet) of it.

The oldest of the major Hawaiian Islands, Kauai, doesn’t have any active volcanoes because it’s no longer over the Hawaiian hot spot. Instead, the dominant ecological process occurring there is erosion, which has sculpted Kauai’s landscape into beautiful cliffs.

As the Pacific Plate continues to move at a rate of roughly seven centimeters (2.75 inches) per year—about the rate at which fingernails grow—new volcanic material is building up over the Hawaiian hot spot. This material will eventually form another Hawaiian island. Located about 35 kilometers (22 miles) off the southern coast of the Big Island, this future island already has a name: Loihi. But don’t book a trip there just yet—Loihi is not visible as an island right now. It’s grown by thousands of meters already, but it is still roughly 1,000 meters (3,280 feet) below the surface of the Pacific Ocean. As lava continues to be deposited on Loihi, scientists predict that it will rise above sea level sometime between 10,000 and 100,000 years from now.

Scientists think that seamounts like Loihi may resemble worlds in the outer solar system like Saturn’s moon Enceladus. By studying the conditions in the deep sea around Loihi, researchers can better understand what other worlds in the solar system may look like.

Explanation:

sana po maka help

4 0
2 years ago
Read 2 more answers
Katherine and Amy are members of the same sorority at college and are members of the school's swim team. They have been trying t
aniked [119]

Answer:

Option (A).

Explanation:

Sociology may be defined as the subject that focus on the study of development and social interaction in society. Sociology is also known as the general science of the society.

Amy and Katherine are the member of same team and Amy shows fast development than Katherine. They both are competitor of each other. This is human behavior to jealous with the person that perform better than them. Here, the development of Amy makes jealous to Katherine and she starts disliking Amy.

Thus, the correct answer is option (A).

5 0
3 years ago
Other questions:
  • Neural tracts that convey life-saving information to the brain concerning burning pain would be ________.
    9·1 answer
  • PLEASE HELP ITS DUE IN 30 min
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the product of meiosis ii
    6·2 answers
  • Is a source of genetic variation that involves the swapping of sections of chromosomes during meiosis. A. Translation B. Transcr
    13·1 answer
  • What 2 types of point mutations will cause a frameshift mutation?
    6·1 answer
  • Plants lose water from their above ground surfaces in the process of transpiration. Most of this water is lost from stomata, mic
    10·1 answer
  • Two morphologically identical Drosophila populations live in Lower Nahal Oren, Mount Carmel, Israel. There are two slopes of a v
    5·1 answer
  • PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU B
    13·1 answer
  • The intensity of the sunlight hitting the planet as Earth revolves around the Sun varies because of what reasons? Select all tha
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!