Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Is that they all have the same routine
Answer:
Image result for what is the purpose of greenhouse gases
Greenhouse gases are certain molecules in the air that have the ability to trap heat in the Earth's atmosphere. Some greenhouse gases, like carbon dioxide (CO2) and methane (CH4), occur naturally and play an important role in Earth's climate. If they didn't exist, the planet would be a much colder place.
Explanation:
Answer:
Explanation: DNA is the information molecule. It stores instructions for making other large molecules, called proteins. and the function of DNA is To carry out these functions, DNA sequences must be converted into messages that can be used to produce proteins, which are the complex molecules that do most of the work in our bodies.
