1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikolay [14]
3 years ago
12

+ Create

Biology
1 answer:
nekit [7.7K]3 years ago
7 0

Answer:

True

Explanation:

Ice pellets are rain drops that have frozen <em><u>before</u></em> they hit the ground.

(They freeze while they're still in the air)

You might be interested in
HURRY PLEASE. List the four types of organic compounds found in all living things and explain why they are important.
Komok [63]

Answer:

Explanation:

Four organic molecules make up all of the life on Earth. Organic molecules contain carbon and hydrogen chemically linked to one another in long chains, with carbon as the backbone and hydrogen atoms attached to the carbon atoms. These atoms' ability to attach to one another allows for the creation of innumerable compounds conducive to life. All organisms need four types of organic molecules: nucleic acids, proteins, carbohydrates and lipids; life cannot exist if any of these molecules are missing.

Nucleic Acids

The nucleic acids are DNA and RNA, or deoxyribonucleic acid and ribonucleic acid, respectively. They make the proteins that are present in almost every structure and perform almost every function in your body. DNA has a twisted ladder-like form, while RNA has many different shapes, depending on its function. DNA typically remains within the center, or nucleus, of a cell; RNA can travel throughout the cell to where it is needed. The backbones of both substances consist of alternating molecules of phosphate and sugar. Nucleotide bases make up the "rungs" attached to the backbone. Of the two types of nucleic acids, DNA is more stable, making it less likely to be broken down than RNA. Your genes are made up of DNA, and each gene provides the code for making a specific protein. RNA helps DNA to make these proteins.

Proteins

Proteins are probably the most versatile of all the organic molecules, making up many structures and executing various functions within organisms. Building blocks called amino acids make up proteins. About 20 different amino acids combine to form all of the various types of proteins on Earth. These amino acids all have almost the exact same composition; the only difference is the R group, which differs in each of the amino acids and gives them their uniqueness. When a protein is made, the protein comes together one amino acid at a time within the ribosome -- a structure that houses protein synthesis. Proteins have four levels of structure: The primary structure is the bonding of amino acids to one another; the secondary structure refers to the folds in certain areas within the protein; the tertiary structure is the ultimate three-dimensional look of the protein; and the quaternary structure consists of smaller protein subunits chemically bonded together to form a larger protein.

Carbohydrates

Carbohydrates comprise the largest number of organic molecules in organisms. Basically, carbohydrates are sugars; their origin can be traced to photosynthesis, the process by which organisms such as plants use sunlight to transform carbon dioxide and water into food. The simplest sugar is glucose, a molecule used to provide fuel for many types of organisms, including humans. The sugars found in foods include: fructose in fruits, galactose in milk, maltose in vegetables and sucrose in table sugar. The starch found in whole grains and vegetables is a complex carbohydrate made of chains of simpler glucose molecules. Your body contains an enzyme called amylase, which breaks down carbohydrates in the food you eat into glucose, which your cells can use as energy.

Lipids

Lipids, perhaps better known as fats, come in different forms in your body and contain the most energy of all the organic compounds. When your body burns lipids for fuel, you get more energy than if you burned the other organic molecules. In your body, fats perform many functions, taking the form of phospholipids and cholesterol, both important components of cell membranes; waxes that provide plants and animals with a protective layer; hormones that signal different functions in your body; vitamins that aid in different cell functions; and steroids, which are important in a number of physiological processes. Fats from animals tend to be more viscous than fats from plants.

5 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Maria is studying fungi in a forest. She makes some observations and takes some notes on a variety of fungi found on the forest
Anna11 [10]

Answer:

Without fungi in the forest, dead and rotting materials would not be broken down, which would cause dead plants and animals to pile up in the forest.

Explanation:

6 0
3 years ago
Phosphorus (P) is the element with the atomic number 15. Which of the
viva [34]

Explanation:

   Isotopes:

                          ₁₅³¹P   and     ₁₅³²P

     Given parameters:

       ₁₅³¹P                                                   ₁₅³²P          

   Mass number = 31                                    32

   Atomic number = 15                                 15

The two atoms are isotopes. Now let us derive numbers of their subatomic particles

                       ₁₅³¹P                                             ₁₅³²P  

Protons              15                                                 15

Electrons           15                                                  15

Neutrons         (31-15) = 16                               (32-15) = 17

Because they are isotopes, they differ in the number of neutrons alone.

Isotopy is the existence of two or more atoms of the same element having the same atomic number but different mass numbers due to the differences  in the number of their neutrons.

We clearly see that the mass number and number of neutrons pertaining to the atom differs. This makes them isotopes.

Learn more:

Isotope brainly.com/question/1915462

#learnwithBrianly

7 0
3 years ago
Which of the following is NOT a property of copper?
Margarita [4]
I believe It’s A I’m sorry if I was wrong
4 0
2 years ago
Read 2 more answers
Other questions:
  • A gunshot wound to the back of the head would cause the victim to be permanently unable to maintain motor coordination. the part
    11·1 answer
  • After receiving a stimulus, the _____ send(s) signals to the appropriate area of the body.
    8·2 answers
  • Hemoglobin transports oxygen in the blood and consists of a chain of 146 amino acids. how many different types of amino acids ar
    9·1 answer
  • Chromatin appears as tightly, cooled, rod-shaped structures in the cell nucleus. true or false
    9·1 answer
  • How does the author organize the text or ideas in the article check all that apply a by using paragraphs to focus on ideas be by
    13·2 answers
  • A rock has been sent on a journey down through the layers of the Earth until it reaches the inner core. Explain what happens to
    9·1 answer
  • Living things
    13·1 answer
  • A denisty of a bottle weighs 0.25N when empty &amp; 0.75N when filled with water &amp; 0.65N when filled with alcohol. Calculate
    14·1 answer
  • HELP ME. don't know what this means
    14·1 answer
  • Before a star is born, the matter that will become the star exists as a what?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!