1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka-Z-Leto [24]
3 years ago
11

Question in picture

Biology
1 answer:
frosja888 [35]3 years ago
5 0

Answer:

<em>The correct option is D) Developing countries will see a decrease in natural resources because of their sharp population increase.</em>

Explanation:

Natural resources can be described as the resources which are present on the Earth from before and are not man-made. Human activities have known to be a threat to many useful natural resources. As the population increases rapidly, the natural resources get depleted. This is causing a concerning situation for the scientists of the world. Especially, depletion of natural resources occurs rapidly in the developing countries where there is no management over the population increase.

You might be interested in
What is Primary succession is mostly caused by
Alexeev081 [22]

Primary succession occurs in essentially lifeless areas—regions in which the soil is incapable of sustaining life as a result of such factors as lava flows, newly formed sand dunes, or rocks left from a retreating glacier

3 0
3 years ago
A population of rabbits lives in a forest. The habitat features many small spaces for hiding. Over many generations, the average
Elina [12.6K]
Selective selection,since being smaller is an advantage the rabbits got smaller similar to evolution
8 0
2 years ago
Read 2 more answers
A client has surgery for an abdominal cholecystectomy and returns from surgery with a nasogastric tube to low continuous suction
motikmotik

The correct answer is: ensure that all tubes are attached to collection devices

An adequately functioning nasogastric (NG) tube should prevent nausea and vomiting because stomach contents are continuously being removed. Using the NG after abdominal surgery is a routine postoperative procedure until gastrointestinal tract starts to function properly. The patency of the tube should be checked together with the amount and character of gastric drainage.



7 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Excretion is the process of removing wastes and excess water from the body.<br><br> True <br> false
JulijaS [17]
True. feces, also known as excrement are the product of excretion.
3 0
3 years ago
Other questions:
  • Sort the phrases into the appropriate bins depending on whether they describe exocytosis, endocytosis, or both.
    7·1 answer
  • Which of these is not a response of internal stimuli?
    14·2 answers
  • What type of living organism is the leptaena fossil?
    10·1 answer
  • A clear object inside the eye that focuses light on the retina
    13·2 answers
  • A cell whose cytoplasm has a concentration of 0.02 molar glucose is placed in a test tube of water containing 0.02 molar glucose
    14·1 answer
  • Which of the following glands is found in the abdomen?
    11·2 answers
  • Describe the internal diameter of the aorta.​
    13·2 answers
  • Which area of this sound wave represents the greatest rarefaction?
    8·2 answers
  • What is the role of each<br> cell part and<br> biomolecule during<br> DNA replication?
    11·1 answer
  • What would the seasons on Earth be like if its axis was tilted like Uranus, perpendicular to its orbit? What would the climate a
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!