Primary succession occurs in essentially lifeless areas—regions in which the soil is incapable of sustaining life as a result of such factors as lava flows, newly formed sand dunes, or rocks left from a retreating glacier
Selective selection,since being smaller is an advantage the rabbits got smaller similar to evolution
The correct answer is: ensure that all tubes are attached to collection devices
An adequately functioning nasogastric (NG) tube should prevent nausea and vomiting because stomach contents are continuously being removed. Using the NG after abdominal surgery is a routine postoperative procedure until gastrointestinal tract starts to function properly. The patency of the tube should be checked together with the amount and character of gastric drainage.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
True. feces, also known as excrement are the product of excretion.