1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkinab [10]
3 years ago
15

Is the moon accelerating as it orbits the earth? explain your reason​

Biology
2 answers:
Nataly_w [17]3 years ago
7 0

Answer:

Gravitational attraction provides the centripetal force needed to keep planets in orbit around the Sun and all types of satellite in orbit around the Earth. This means gravity makes the Moon accelerate all the time, even though its speed remains constant.

Explanation:

yan [13]3 years ago
3 0

Answer:

The acceleration due to gravity depends on the mass of the body, the distance from the center of mass, and a constant G, which is called the "universal gravitational constant". ... The acceleration due to gravity on the surface of the moon is 1.620 m/s2. 2) The radius of the Earth is 6.38 x 106 m.

googles answer :

Gravitational attraction provides the centripetal force needed to keep planets in orbit around the Sun and all types of satellite in orbit around the Earth. ... This means gravity makes the Moon accelerate all the time, even though its speed remains constant.

You might be interested in
A volcano begins erupting after sitting dormant for 200 years. lava spills from the vent and poured down the sides of the mounta
Anika [276]

Answer:

A

Explanation:

A  non explosive eruption

6 0
3 years ago
during replication, DNA _____. a. remains intact b. makes rna c. is copied d. directs protein synthesis
yanalaym [24]

You must just analyze the words. Replication is a synonym of copy, so the only possible answer is C.

Hope it helped,

Happy homework/ study/ exam!

6 0
3 years ago
Read 2 more answers
___ have many angiosperm-like features
Crank
Ginkgos have many angiosperm-like features
7 0
3 years ago
Passive movement of fluids and bacteria from the interior of the small intestine through the space between cells of the intestin
Verdich [7]
<h2>Option (A) is Right Answer</h2>

Explanation:

    (A) Tight junctions

  • <em>Tight junctions</em> are a narrow band in epithelial cells just <em>beneath their apical surface</em>
  • They comprise a system of <em>another protein and claudins</em>
  • Tight junctions provided two major functions such as <em>The  ions through space between cells  and They limit the section of particles</em>  
  • Tight junctions may be provided fill in as weak pathways by framing specific systems for<em> little cations, anions, or water</em>
  • <em>Tight junctions are available just invertebrates</em>
7 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Other questions:
  • Action potentials are conducted more rapidly when transmission is
    15·1 answer
  • Neurons localized within the ________ control the secretion of acth.
    15·1 answer
  • Which atmospheric conditions would cause the greatest rate of evaporation from a lake?
    7·2 answers
  • What would you expect from an exothermic reaction
    7·2 answers
  • What is the production of a phenotype that is between 2 homozygus parents?
    8·1 answer
  • Which of the following statements is true? The Milky Way Galaxy is the only galaxy in the universe. The earth is always the same
    13·1 answer
  • How does the “fluid mosaic model” describe the structure of the plasma membrane?
    6·1 answer
  • In simple dominance what is the result when a dominant allele pairs up with a recessive allele
    14·1 answer
  • Post malone is the best
    14·2 answers
  • What was the reason for the addition of the Bill of Rights to the U.S. Constitution?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!