1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nitella [24]
3 years ago
9

The name given to the adult stem cell is

Biology
1 answer:
lozanna [386]3 years ago
4 0
Somatic stem cells.       
You might be interested in
Fast!!Will mark as brainliest!!
padilas [110]
Its kinetic to potential because you made it to stop its lose energy 
6 0
3 years ago
An increase in biodiversity generally causes what ?
stepladder [879]
An increase in biodiversity can either cause over-population of several different species or an increase in competition factor(s). Those are the most common results.
3 0
2 years ago
How are human embryonic stem cells and skin cells taken from the same person the same? How are they different? What causes the d
dusya [7]

They are different because the <em>embryonic stem cells</em> can be all cell types of the body because they are Pluripotent. Where as the <em>adult stem cells </em>are thought to be limited to only their tissue of origin

Pluripotent (<em>Adjective)</em>

An immature stem cell, capable of giving rise to to several different types of cell.

5 0
3 years ago
In your own words, explain how the changes in the temperature of ocean water causes movement of ocean water from one place to an
ipn [44]

Well, many people might associate this to the increase in the movement of particles that occurs along with the increase in temperature, but that might not be enought to move ocean water to different places.

I'd relate it to density. Because, the higher the movement of particles, the lover the density. Which means that if we start cooling and sinking bringing new water to the surface, and if that becomes a cycle, along with water currents, we can create a movement.

↑ In my opinion, that is a really good point, so you should elaborate more on how the water currents will affect the process, and that should be it.

Hope it helped,

BioTeacher101

6 0
3 years ago
Describe the direction of the flow of thermal energy if a bowl of ice cream sits on the counter of the kitchen.
mr_godi [17]

Answer:

The bowl of ice cream contains ice cream with temperature below freezing point. A hot body contains more thermal energy than a cold body. Thermal energy only flows from a hot body to a cold body, and not the reverse.

The bowl of ice cream contain less thermal energy than it sorrounding envoirment (air and the kitchen counter), this creates a temperature gradient that forces thermal energy from the sorrounding envoirment into the bowl of ice cream because, according to thermodynamics, all bodies always tend to be in thermal equilibrium with its sorrounding. The thermal energy flows into the bowl of ice cream until it has the same thermal energy with its sorrounding; bringing the thermal gradient between them to zero.

6 0
3 years ago
Other questions:
  • What type of organisms use photosynthesis
    11·1 answer
  • What is the idea of Continental Drift?
    6·2 answers
  • Do some organisms outcompete eachother
    13·2 answers
  • There are ___lobes in the brain.
    11·2 answers
  • Which includes the physical characteristics of an organism?
    5·2 answers
  • Describe the 3 stages of photosynthesis and were they take place in the cell?
    10·1 answer
  • The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
    14·1 answer
  • Which of the following statements about crossing over is TRUE?
    10·2 answers
  • 7 extra points please help its for biology on potential energy!!!
    5·1 answer
  • Which diagram correctly shows how heterozygous alleles are found on homologous chromosomes?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!