1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liono4ka [1.6K]
3 years ago
9

(1 point)

Biology
2 answers:
den301095 [7]3 years ago
8 0

Answer:

Some sources of family stress are illness, financial problems, and drug abuse, What is another  major source of family stress? Stress differs, this brings the saying that different folks with different strokes.

without any iota of doubt, every family has two or more stresses which could have direct or indirect effect on the family and children.  It could be poverty, religion differences, educational crisis, psychological stress, mental health, background clashes, individual differences among others

Explanation:

zhannawk [14.2K]3 years ago
4 0

(B. Separation and divorce

Is a really big burden on families world wide. Other answers have no effect compared to the emotional weight of losing a family member.

You might be interested in
How long does it take for a package to come from uk to arizona?
Sunny_sXe [5.5K]
It depends most packages take 2-3 weeks so I’m guessing about 4 or 5?
4 0
4 years ago
Review of the scientific method: Sea turtles navigate the world’s oceans by using magnetic fields. The state of Georgia has aske
Mumz [18]
Hypothesis : the new electric station will not affect sea turtle navigation
Control group: the first group
Experimental group: the second group
Independent variable : not sure
Dependent variable: not sure
Controlled variables : the strong magnet
Type of data collected : the route and time the turtles take to return to their starting location.
Hope this helps some!
7 0
3 years ago
If an organism expresses a recessive phenotype, can you tell the genotype? Explain your answer by giving an example.
kolezko [41]

Phenotype is the physical appearance
Genotype is the traits in letters.

lets say green eyes...
having the gene GG, Gg, except gg will yield green eyes
so, if you see someone with green eyes, he/she must either have two dominant trait or 1 dominant and 1 recessive trait. Since you gave to us that an organism expresses a recessive phenotype, you can automatically tell that the person will have 1 dominant and 1 recessive, or Gg.

However, if that is not given, you wont be able to tell the genotype based on looking at a person.
8 0
3 years ago
The influences of nature on development refer to:
Mariana [72]

Answer: A. environmental influences

A development in terms of biology is a gradual process of changes that occurs in an organism until the organism attains maturity or adulthood. Development can be physiological and mental development. Environmental influences are influences of nature on development. Some of the environmental influences are nutrition, altitude, temperature and climate. For example sunny weather conditions in a region can induce dark complexion in the habitants.

5 0
3 years ago
Read 2 more answers
CAN SOMEONE PLZ HELP ME!! THIS IS THE 25th TIME I POST THE SAME QUESTION SO PLZ
777dan777 [17]

Answer:

Independent variable-amount of water

Dependanot variable-Bounce, vescosit, and stretchiness

Control-Standard Slime

Constant-Container

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • A plate moves 200m in 10,000 years. what is the rate in cm/year
    10·1 answer
  • Please help jdixnwjdj
    15·1 answer
  • As an example of hormonal communication, when osmoreceptors of the _______________ detectdehydration, a signal to the posterior
    12·1 answer
  • Which plane divides the body into left and right portions?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • There are many different types of scientific investigations, including controlled experiments, observational field studies, the
    14·2 answers
  • Which characteristics can be inherited?
    11·2 answers
  • Which of the following statements about hormones are correct? Hormones can be peptides, steroids, or amino acid derivatives. Hor
    8·1 answer
  • Why is every step of the scientific method necessary, in order for a
    9·1 answer
  • Explain the interrelationship between the Elodea plant and paramecia in a pond ecosystem?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!