1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali [406]
4 years ago
9

When a child is injured, you should focus on:

Biology
2 answers:
makvit [3.9K]4 years ago
5 0

Answer:

B

Explanation:

aiding the injured child must be prior to all because he is the sufferer and must be treated first and all other circumstances comes after

Damm [24]4 years ago
4 0

Answer:

C

Explanation:

You might be interested in
Suppose you want to design and build a house. How would you communicate your design plans with the construction crew that would
barxatty [35]
Show them what you want
6 0
3 years ago
Circulatory systems in insects and birds. Infer three similarities and three differences.
In-s [12.5K]

Answer:

can i have brainliest pls

Explanation:

7 0
3 years ago
Six layers of gray matter on top of a layer of white matter would describe: the limbic cortex. the basal ganglia. the neocortex
KiRa [710]

Answer:

the neocoretex

Explanation:

from wikipedia "The neocortex, also called the neopallium, isocortex, or the six-layered cortex, is a set of layers of the mammalian cerebral cortex involved in higher-order brain functions such as sensory perception, cognition, generation of motor commands,[1] spatial reasoning and language.[2] The neocortex is further subdivided into the true isocortex and the proisocortex."

3 0
2 years ago
Explain how parts of a glucose molecule are used to make amino acids.
ladessa [460]

Glucose particles are ingested from gastrointestinal cells into the circulatory system. The circulation system then, at that point, conveys the glucose particles all through the body. Glucose enters every cell of the body and is involved by the cells mitochondrion as fuel.

7 0
2 years ago
DNA and rna are both
julia-pushkina [17]

Answer:

D

Explanation:

DNA stands for deoxyribonucleic acid, while RNA is ribonucleic acid. Although DNA and RNA both carry genetic information, there are quite a few differences between them. This is a comparison of the differences between DNA versus RNA, including a quick summary and a detailed table of the differences

8 0
2 years ago
Other questions:
  • A single occupancy padded cell for the temporary holding of inmates harmful to themselves and or others is a ____?
    14·1 answer
  • Agents of what ? deposit sediments are when they lose their energy of motion
    12·1 answer
  • The temporary storage of energy in ATP molecules is part of which process?
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The use of harmful substances in food production​
    8·1 answer
  • HELP ASAP PLSSSSSSSSSSSS
    13·2 answers
  • Protecting Yourself from Overexposure to the Sun
    12·1 answer
  • Type your one-page report here. Be sure to answer all of the following questions:
    11·1 answer
  • 1. A one-eyed purple people eater is crossed with a two eyed purple people eater. All of their offspring have two eyes. A. Which
    13·1 answer
  • In which case is potential energy increasing?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!