1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mina [271]
3 years ago
12

Why do classification systems change over time?

Biology
2 answers:
ICE Princess25 [194]3 years ago
8 0

the systems change to incorporate new groups of organisms

Elina [12.6K]3 years ago
6 0

Changes to the classification system have meant that the classification of some species of organisms has changed too. The system had to be changed to incorporate this new group or organisms.

Hope This Helped


You might be interested in
How do humans affect biomass<br><br> Pls help me I can’t find anything
Nimfa-mama [501]

Answer:It includes the human-initiated burning of vegetation for land clearing and land-use change as well as natural, lightning-induced fires. Scientists estimate that humans are responsible for about 90% of biomass burning with only a small percentage of natural fires contributing to the total amount of vegetation burned.

Explanation:

i just copied and pasted it off the internet sooo.... yeah

5 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
Select the four natural events that could cause local competition for natural resources.
Ket [755]

Answer:

hurricane, tornado, drought, flood

Explanation:

7 0
3 years ago
Which of the following materials could have been found in the giant clouds that form the SolarSystem
kondaur [170]

It is said that the materials found in the giant cloud that formed our solar system are comparable to the ones we have in the solar system today, which are Hydrogen and Helium!

5 0
3 years ago
Dinosaurs survived for at least 700,000 years after meteorite collision Discuss how the research in this article shows how new t
Novay_Z [31]

New research shows how technology and experimental methods in science can always help and be of help when trying to find out the fine details and see how a theory should be updated and what is needed to be corrected in a certain hypothesis or theory. 


Dinosaurs they are termed as a diverse group of reptiles. They first appeared in the time of triassic.

After triassic and jurassic extinction event, dinosaurs became terrestrial vertebrates.




8 0
4 years ago
Read 2 more answers
Other questions:
  • During which phase does the nucleus begin to break down?
    9·2 answers
  • Life is the topic of this course. Write an essay about the characteristics of life discussed in Section 1 of this unit. Your ess
    9·1 answer
  • A student examines a sample of pond water under a microscope and observes a single-celled heterotrophic eukaryote swimming throu
    10·1 answer
  • Which of the following terms are used to indicate that cell membranes will allow only certain molecules to pass through without
    12·1 answer
  • List several causes of biodiversity loss.
    11·1 answer
  • In the above food web, energy is transferred from wheat to the mouse and from the mouse to the coyote when these organisms are c
    8·2 answers
  • A chicken with black feathers (BB) is crossed with a chicken with white feathers (WW). The offspring have black and white feathe
    8·1 answer
  • Explain how you identify the type of information that appears in various medical reports
    12·1 answer
  • The car company is trying to make a car that is more fuel efficient, meaning it takes less force to get the car to move. Explain
    12·1 answer
  • Use each vocabulary term in a sentence.<br> 13. controlled study<br> 14. environmental ethics
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!