1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
3 years ago
14

What are the structure and function of the cytoskeleton in a cell?

Biology
2 answers:
kirill [66]3 years ago
7 0

Answer:

The cytoskeleton of a cell is made up of microtubules, actin filaments, and intermediate filaments. These structures give the cell its shape and help organize the cell's parts. In addition, they provide a basis for movement and cell division.

Explanation:

Varvara68 [4.7K]3 years ago
6 0

Answer:

The cytoskeleton of a cell is made up of a few key components:

microtubules

actin filaments

intermediate filaments

Those three components/structures help give the cell its shape, and organize its parts.

I hope I helped you, and a "Brainliest" is always appreciated! ☺

You might be interested in
This structure serves as the garbage collector / waste disposer for the cells: _____________________________
almond37 [142]

Answer:

it is the lysosome

Explanation:

8 0
3 years ago
HURRY PLEASE A food web. Fox consumes Shrew, Mouse, and Rabbit. Shrew consumes Grasshopper. Mouse consumes Grasshopper and Grass
Salsk061 [2.6K]

Answer:

It will increase the grass population.

It will decrease the snake population.

It will increase the grasshopper population

3 0
3 years ago
Read 2 more answers
Which of the following statements must be *FALSE*?
Elan Coil [88]
Hhhhhhhhhhhhhhhhhhhhh
3 0
3 years ago
________ is stress-reduction technique whereby electronic equipment measuring a person’s involuntary (neuromuscular and autonomi
iVinArrow [24]
Biofeedback <span>is stress-reduction technique whereby electronic equipment measuring a person’s involuntary (neuromuscular and autonomic) activity helps him gain a level of voluntary control over these processes.

Biofeedback therapy will help you to relax and control involuntary response related to stress like heart rate, sweating, temperature and blood pressure. The electronic equipment will let you know when there is any sign of stress, therefore you know when to calm down yourself.</span>
6 0
3 years ago
Nitrogen is changed into which substances before being used by living things
ANEK [815]

Answer:

nitrogen can be changed into macromolecules like proteins and nucleic acids (DNA and RNA)

Explanation:

8 0
3 years ago
Other questions:
  • Explain what the line plot on a climate diagram shows
    13·1 answer
  • Which organelle in a eukaryotic cell is most noticeable under a microscope?
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How do different animals get the energy they need to live?
    11·1 answer
  • Is a crashed object from space that leaves a "dent".
    11·2 answers
  • Clouds can trap heat emitted from the earth's surface in a kind of greenhouse effect. True False
    5·2 answers
  • they went home and found that their mother is using a plunger because the kitchen is blocked.They have two diffrent size of plun
    13·1 answer
  • Which statement about inheritance is true?
    13·2 answers
  • What does evidence show about radial symmetry in invertebrates? a. all invertebrates with radial symmetry are closely related b.
    8·1 answer
  • Blood contains the rhesus protein.<br><br><br> blood does not contain the rhesus protein.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!