1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
8

Who postulated the “nature versus nurture” hypothesis?

Biology
1 answer:
Katyanochek1 [597]3 years ago
4 0
I believe the correct answer from the choices listed above is option A. It is charles darwin who postulated the “nature versus nurture” hypothesis. <span>The phrase </span>nature and nurture<span> relates to the relative importance of an individual's innate qualities</span><span> as compared to an individual's personal experiences </span><span>in </span>causing<span> individual differences, especially in </span>behavioral<span> traits. </span>
You might be interested in
Need help 50 points feel the boxes
Mama L [17]

Answer: after organelles it cells,tissues,organs,organ system then it give you the last one which is organism.

Explanation:

7 0
3 years ago
What does the word "Cuneiform " means?
ki77a [65]

Answer:

It's an old writing system from ancient Mesopotamia.

Explanation:

If you check Wikipedia you'll see that cuneiform was a writing system from the sumerians. it comes from the Latin term that means wedge, which is kind of the tool they used back then to wedge shape clay pieces.

4 0
3 years ago
Read 2 more answers
The movement of the tectonic plates is caused by
Licemer1 [7]
A.) Convention currents in Earth's mantle
4 0
3 years ago
Read 2 more answers
Which is a sustainable practice?
Ostrovityanka [42]

Answer:

A. wind farms

7 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • What function do chloroplasts perform?
    10·2 answers
  • Messenger RNA carries a(n) ___________ of the DNA’s instructions out of the nucleus to the ___________.
    14·1 answer
  • Part A A researcher notices that in a certain moth species, some females prefer to feed and lay eggs on domesticated solanaceous
    5·2 answers
  • In a 200m race, athletes sprint the entire length. What type respiration is most likely occurs near the finish line.
    6·1 answer
  • What would happen to the rate of a reaction if the concentration of substrate was increased after the point of saturation? The r
    11·2 answers
  • What animals and plants live in the Tropical Rainforest
    13·1 answer
  • What are the advantages of having a double helix contain 2 dna strands
    9·1 answer
  • Disinfectants kill microbes but do not necessarily remove them.<br><br> True<br> False
    15·2 answers
  • Which of the following is a likely result of deforestation?
    12·1 answer
  • What does belive mean ? people
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!