1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
S_A_V [24]
3 years ago
6

Low genetic diversity _____. helps a population evolve can result in extinction is not a problem with modern-day organisims is t

he main cause of mass extinctions
Biology
2 answers:
PSYCHO15rus [73]3 years ago
4 0

Low genetic diversity does not help in evolution in population of a species or organism. Genetic diversity paves the way for the evolution of organism. Low genetic diversity may lead to the extinction of a species. When many species gets extinct then it leads to mass extinction.

During environmental change, that species evolve whose alleles are able to tolerate or resist the disease or any other stressful condition. Genetic diversity results in natural selection of the species.

Inessa [10]3 years ago
3 0

Answer:

Low genetic diversity does not help in evolution in population of a species or organism. Genetic diversity paves the way for the evolution of organism. Low genetic diversity may lead to the extinction of a species. When many species gets extinct then it leads to mass extinction.

odyssey ware

You might be interested in
People do stuf to the area . Explain how animals is involved
11111nata11111 [884]
Habitat loss is contributing to the permanent loss of species, the weakening of ecosystems, and is impacting the overall health of the planet.

Example:

While tree-clearing is a significant cause of habitat loss in Australia, other major contributing factors include altered bushfire frequency and the introduction of pest species that make habitats unsafe for native species or outcompete them. Meanwhile, on the Great Barrier Reef, the impacts of human-induced climate change are altering the habitats of corals, leading to large-scale coral bleaching. Over time, destruction of such habitats leads to reduced biodiversity and weakening of the Earth’s ecosystem.
5 0
2 years ago
Pls help i’m miserable
goblinko [34]

Answer:

i dont know what to help you with.. i dont see anything

Explanation:

3 0
3 years ago
Which one is prometaphase
arlik [135]

Answer:

A

Explanation:

prometaphase  is the process that seperates the duped genetic meterial carried on a nucleus

5 0
2 years ago
The epigastric region is a portion of the cavity. multiple choice pelvic pleural vertebral abdominal
svetlana [45]

The epigastric region is a portion of the <u>abdominal </u>cavity.

The correct option is d.

The greatest hollow area in the body is the abdominal cavity. Its lower limit is the upper plane of the pelvic cavity, and its upper barrier is the diaphragm, a sheet of muscle and connective tissue that divides it from the chest cavity. The spinal column, as well as the abdomen and other muscles, encircle it vertically.

The epigastrium is the top portion of your abdomen that is immediately below your rib cage. The epigastrium houses your pancreas and the duodenum, a section of your small intestine. Additionally, your stomach and liver are partially located here.

To learn more about epigastric region, refer

brainly.com/question/28237650

#SPJ4

6 0
1 year ago
Human digestion of food begins in the _______, where the enzyme _____ breaks down a small amount of starch. Mouth; amylase stoma
Alexandra [31]

The digestion of the food in humans begins in the mouth. In the mouth, the salivary amylase enzyme digests and breaks down a small amount of the starch present in the food. The digestion process begins right in the mouth. and continues till the intestine. The carbohydrates (starch) are the ones whose digestion starts in the mouth.

Hence, the blanks can be filled with 'mouth and amylase' respectively.

7 0
2 years ago
Other questions:
  • Fissure is the term that generally refers to the depression between
    9·1 answer
  • Explain how flooding rice feilds reduces the need for herbicides and pesticides in rice farming
    10·1 answer
  • Why would someone want to make minerals when they are found in nature?
    5·1 answer
  • The major problem with hydrogen as an alternative source of energy is that none exists on the surface of the earth.
    13·1 answer
  • In humans, a combination of XX chromosomes results in a female zygote and that of XY results in a male zygote. From whom does a
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • 1) a student wondered if butterflies would show any differences in their wing color if, as caterpillars, they were grown in the
    9·1 answer
  • What technologies did scientists not use to develop the theory of seafloor spreading
    6·1 answer
  • What factor(s) can affect diffusion speed?
    15·1 answer
  • g Type I diabetes is caused by destruction of the beta cells of the pancreas, the cells that produce insulin. In most cases, the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!