There would be increase in oxytocin in one's cerebrospinal fluid in the brain causing a major role in the mother's behavior. Breastfeeding would release the oxytocin from the mother's brain. It allows one's baby to get milk from the breasts causing one's uterus to return back to it's normal size after birth. It also nourishes love, nurture and bond between the mother and child.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Higher order functions in language production, such as attention, are probably specifically impaired in cases of <span>transcortical motor</span> aphasia.
Answer:
I think its A. Central. Sorry if im incorrect
