1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
3 years ago
9

Lenore delivers a healthy baby girl. Her medical documentation indicates that she has had a normal delivery with no complication

s antepartum, during the delivery, or postpartum. How does this information influence which codes you assign?
Biology
1 answer:
marysya [2.9K]3 years ago
8 0

The correct answer is Code 650.

Normal Delivery Code 650 is used in cases when a woman is admitted for a full-term normal delivery. It means that she delivered a single, healthy infant without any complications, when it requires no or minimal assistance.


You might be interested in
If the relative humidity of the air is 50 percent, how much water can the air hold?
zlopas [31]
It depends on the tempature but at 100% that means it is raining  so D.
6 0
3 years ago
Read 2 more answers
How the structure of DNA determines the structure of proteins?
Kruka [31]

Answer:

DNA carries the genetic information for making proteins. ... The base sequence determines amino acid sequence in protein. Messenger RNA (mRNA) is a molecule which carries a copy of the code from the DNA, in the nucleus, to a ribosome, where the protein is assembled from amino acids.

Explanation:

(meow) <3

3 0
3 years ago
How is a scientific theory different from everyday theories proposed by random individuals?
Alex17521 [72]

Answer:

D

Explanation:

4 0
4 years ago
Read 2 more answers
A celestial object takes six to seven years to revolve once around the Sun. It’s made mostly of ice, some of which vaporizes whe
Nadusha1986 [10]
A comet. It’s a smaller celestial body that’s composed of mainly ice and dust.
3 0
3 years ago
Read 2 more answers
Hallucinations, disorientation and the loss of a sense of time are symptoms of what disorder??
Roman55 [17]
Delirium... hope this helps.
4 0
3 years ago
Other questions:
  • What kinds of lipids make up the bilayer that forms a cell membrane ?
    5·1 answer
  • Which type of relationship exists between non-native kudzu and native tress and shrubs
    5·2 answers
  • Surfactant helps to prevent the alveoli from collapsing by
    8·1 answer
  • A topographic map indicates that a mountain’s slope is very steep by using _____. contour lines that are very close together con
    6·2 answers
  • The following is one of the food chains within the Alaskan coast. The sea otter feeds on the sea urchins and the sea urchins fee
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • When we have a vaccination what is injected into our body?
    11·1 answer
  • Is there anything farther than space itself?
    15·2 answers
  • What are the building blocks of all organisms?
    11·1 answer
  • A newly discovered disease features DNA methylation at cytosines outside of the CpG context. Which cells were most likely involv
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!