1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
3 years ago
10

Ethology is the study of animal _____.

Biology
2 answers:
Rzqust [24]3 years ago
5 0
<span>Ethology is a branch of zoology concerned with the study of animal behavior. Ethologists take a comparative approach, studying behaviors ranging from kinship, cooperation, and parental investment, to conflict, sexual selection, and aggression across a variety of species.</span>
laila [671]3 years ago
3 0

Answer:

<h3>Behavior</h3>

Explanation:

Ethology is a branch of zoology in which zoologist study about the animal behaviour. Ethologists  adopt a comparative method to study the varied form of animal behaviour ranging from -  Sexual selection, aggression, co-operation between two organism, kinship etc.  

Researchers study about both the classical behavior patterns (FAPs – Fixed action patterns) as well as the adaptive changes in behavior brought in by the evolution.  

You might be interested in
Which of the following is true concerning rainforest deforestation?
Molodets [167]

Answer:

B

Explanation:

When deforestation takes place, it heats up the atmosphere causing more global warming.

3 0
2 years ago
HELP EXTRA POITNS BRAINLIEST !!!
patriot [66]
I think the second option is the best (by making the ramps height and length equal) because the first option will require more pushing, the third option will only make the ramp lighter which could cause it to not stay in place, the last option would make it harder to push the boxes up because the rubber will make it harder to slide the boxes up. I hope this helps:)
3 0
2 years ago
Propane is burned to provide the heat in many cooking grills. The chemical
tangare [24]

Answer: it's 3CO2+4H2O+Energy

Propane is a linear alkane of formula C3H8. It is mainly used as fuel (this is the main component of liquefied petroleum gas) in cooking and chemical industry reactions.

The reaction of its complete combustion by the presence of oxygen is:

C3H8 (gas) + 5O2  ==> 3 CO2 + 4H2O + energy (2220⋅kJ)

As we can see, propane can release carbon dioxide and water as every combustion reaction, and a lot of energy in the form of heat.

6 0
1 year ago
Name one cell type that continues to divide throughout a person's lifetime and one that doesn't continue to divide throughout a
Otrada [13]
So base on the question that states and ask to give the name of one cell type that continues to divide throughout a person's lifetime and also on who does not, with that question, the cell that divide through persons lifetime is a Mitosis or skin cells, an example to this is the skin, and the who doesn't divide is i think the brain cells, it doesn't regenerate
6 0
3 years ago
How is wind energy different from energy from fossil feels?
amm1812

first of all, wind energy is a renewable source of energy and fossil fuels is a non renewable

the method of obtaining them is also different i.e , wind energy can be obtained when wind turns turbines , and fossil fuels are burned to give energy...

3 0
3 years ago
Other questions:
  • Why can we sometimes hear noises in the stomach during digestion???
    14·1 answer
  • What is the microclimate of a hilltop like?
    5·1 answer
  • Which of the following is NOT true about
    8·1 answer
  • Suppose there are 500 units of energy available at the producer level of the energy pyramid. Approximately how many units of ene
    12·1 answer
  • The main raw material for photosynthesis is what<br>​
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How did early land animals differ from those common today?
    15·1 answer
  • Cómo se trasmite la gonorrea?<br><br>​
    5·1 answer
  • Which of the following statements about metabolism are true? 1) Catabolism is the process in which complex substances are broken
    15·1 answer
  • Which of the following
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!