1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elixir [45]
3 years ago
13

In the Hardy-Weinberg equation shown below, p is the frequency of the

Biology
1 answer:
ycow [4]3 years ago
8 0

Answer:

B

Explanation:

You might be interested in
In which case is an inherited mutation most likely to be expressed? It will be expressed only if the mutation is present in the
Sonbull [250]
The first one. Gametes are the reproductive cells: sperm and egg cells. These contain the info that is passed on to the offspring, so an inherited mutation must be present in the gametes.
8 0
3 years ago
Read 2 more answers
Will the scientific facts of today change in the future?
Lina20 [59]
It depends on the facts and how they will change
8 0
3 years ago
Read 2 more answers
Which type of gene therapy results in alteration of the DNA of a gamete or a fertilized ovum?
larisa86 [58]

Answer:

The correct option is: <u>e. Germline gene therapy</u>

Explanation:

The <u>germline gene therapy</u>, GGT is the <u>modification of the germ cells</u>. In this therapy, a functional gene is introduced into the genomes of the gametes. Such a modification of the germ cell results in all the cells of the organisms to get modified. This change can therefore be <u>passed on to the next generations.</u> Many countries such as Canada, Germany and Switzerland, have prohibited the use of the germline gene therapy on humans.

7 0
3 years ago
Which type of specimen must be chilled if testing will not be performed immediately?
Marat540 [252]

Urine Specimen must be chilled if testing will not be performed immediately.

<h3>What is Urine?</h3>

Urine is a liquid byproduct of human and many other animal metabolism. Urine travels from the kidneys to the urinary bladder via the ureters. Urine is discharged from the body through the urethra as a result of urination.

Many by-products of cellular metabolism, such as urea, uric acid, and creatinine, are nitrogen-rich and must be removed from the bloodstream. These by-products are excreted from the body through urination, which is the major way for excreting water-soluble compounds. A urinalysis can identify nitrogenous wastes in mammals.

To learn more about urine visit:

brainly.com/question/27454851

#SPJ4

5 0
1 year ago
How is energy removed from ATP so muscle contraction can occur?
kenny6666 [7]
After the power stroke, ADP is released<span>; however, the cross-bridge formed is still in place, and actin and myosin are bound together. </span>ATP can<span> then attach to myosin, which allows the cross-bridge cycle to start again and further </span>muscle contraction can occur<span> </span>
6 0
3 years ago
Other questions:
  • Which of the following statements about receptor potentials is FALSE?a.Odor molecules can act as stimuli.b.The receptor potentia
    8·2 answers
  • Click on "Embankment dam at a gold mine." Of the two opinions to consider in this case, which one presents a stronger argument?
    10·1 answer
  • How are sandbars and deltas similar?
    7·1 answer
  • Which of the following was an early realization that gave rise to Darwin's theory of natural selection?
    14·2 answers
  • Which features form near convergent oceanic plates? Select the two correct answers.
    13·1 answer
  • In a certain species of rabbits, black coat color is dominant over brown coat color. What is the probability of producing a rabb
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • During early developement all cells in the embryos of a multicellular organism are identical. Later in developement the cells be
    9·1 answer
  • In order for our cells to metabolism N2 into 2NH3, a total of _____________ ATP is required.
    7·1 answer
  • Please provide the complementary DNA sequence, mRNA sequence, tRNA sequence, and amino acid sequence for the following DNA segme
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!