1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leona [35]
3 years ago
7

Please answer asap.......

Mathematics
2 answers:
Brums [2.3K]3 years ago
8 0

Answer:

"-" always means "less" or a "drop"

Therefore the answer is a drop of 8 meters (the first one)

Hope this helps! :]

Leviafan [203]3 years ago
3 0
A drop of 8 meters I think
You might be interested in
Can you help with #13 and #14<br><br> sorry about the last one :/
Dima020 [189]
Number 13 is 40 in
number 14 is 2.5
8 0
3 years ago
Read 2 more answers
??fkdkddkdkdkdkdkddkdkdkdkdkdkwpdle,ws
GalinKa [24]
The answer is (D) ....
6 0
3 years ago
Read 2 more answers
A)$150 at 3 % interest for 2 years
tamaranim1 [39]

Answer:

A)  159.135 = X

B) 2,531.25 = X

C)  6,187.5 = X

D) 831,947.46 = X

Step-by-step explanation:

The following investments are required to be calculated:

A) $ 150 at 3% interest for 2 years

B) $ 750.00 at 1/2% interest for 3 years

C) $ 2,250.00 at 1 3/4% interest for 1 year

D) $ 2,550.00 at 3 1/4 interest for 4 years

Therefore, the following calculations must be performed:

A)

150 x (1 + 0.03) ^ 2 = X

150 x 1.03 ^ 2 = X

159.135 = X

B)

750 x (1 + 0.5) ^ 3 = X

750 x 1.5 ^ 3 = X

2,531.25 = X

C)

2,250 x (1 + 1.75) = X

2,250 x 2.75 = X

6,187.5 = X

D)

2,550 x (1 + 3.25) ^ 4 = X

2,550 x 4.25 ^ 4 = X

831,947.46 = X

4 0
3 years ago
20 - 4 { 20÷ 7 ( 7 - 3 )}​
hodyreva [135]

20 -4 { 20÷ 7 ( 7 - 3 )}

20 -4 { 20 ÷ 7 * 4 }

20 - 4 { 2.85 * 4 }

16 * 11.42

182.85

4 0
3 years ago
Read 2 more answers
Find the interest rate needed for the sinking fund to reach the required amount. Assume that the compounding period is the same
Maslowich

Answer:

so rate is 4.72 %

Step-by-step explanation:

Given data

time (t) = 5 year  = 5×4 = 20 quarterly

amount = $27456

principal = $1225

to find out

interest rate (r)

solution

we use here amount formula that is

amount = principal ((1+r)^{t} -1 ) / r      .....................1

put all value principal , amount and time in equation 1 and we get rate

rate is r/4 because it is quarterly payment

amount = principal ((1+r/4)^{t} -1 ) / r/4

27456 = 1225 ((1+r/4)^{20} -1 ) / r/4

((1+r/4)^{20} -1 ) / r/4  = 27456/ 1225

((1+r)^{20} -1 ) / r  = 27456/ (1225 × 4)

((1+r)^{20} -1 ) = r 27456/ (1225 × 4)

now by the tvm solver and amount  $27456

graph value

we get r = 0.0472

so rate is 4.72 %

5 0
3 years ago
Read 2 more answers
Other questions:
  • The logistic equation below can be used to model population growth. In the equation, P is population, t is time, and e = 2.72.
    9·1 answer
  • Which is bigger 0.6 or 0.7
    13·2 answers
  • What is the axis of symmetry for y= x^2 + 4x + 3
    13·1 answer
  • Find the MAD of:<br>1,10,7,6,4,8<br>Data<br>Mean<br>Differenc
    9·1 answer
  • I need help with this math.
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Nicholas spent 40% of his savings to pay for a video game that cost him $40. How much money was in his savings to begin with?
    15·1 answer
  • Evaluate this and answer as your choice<br> 25 2/3
    14·1 answer
  • 1. You have 23 coins, all quarters and dimes, totaling $4.85. How many of each coin do you<br> have?
    12·1 answer
  • Solve for x. NEED ANSWER ASAP TYY SO MUCH IN ADVANCE
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!