1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ZanzabumX [31]
3 years ago
9

The endosymbiotic theory states that chloroplasts and mitochondria evolved as a result of

Biology
2 answers:
Sidana [21]3 years ago
8 0

a prokaryotic cell engulfing a bacterial cell.

blsea [12.9K]3 years ago
6 0
A Eukaryotic cell engulfing a bacterial cell.

You may want to know that the bacteria which used to photosynthesise , after they have been engulfed by an eukaryotic cell , they evolved into Chloroplasts .
However for the bacteria which used to respire , they have evolved into mitochondria.

Hope this helps :) Good Luck !
You might be interested in
This type of exocrine gland is a simple, branched acinar gland connected to a hair follicle.
Brrunno [24]
I believe the answer is Sebaceous gland. Sebaceous glands are microscopic exocrine glands (glands that secrete and produce substances using ducts to an epithelial surface). They are found in the skin and secrete oily or waxy substance called sebum. Sebum functions to lubricate and waterproof the skin and hair of mammals. 
8 0
3 years ago
Research the name of the receptor of the five senses and describe how the receptor works.
tresset_1 [31]

Answer:

Photoreceptors - Eyes

Phono receptor - Ears

Olfactory receptors - Nose

Gustatory receptors - Tongue

Thermoreceptors - skin

Explanation:

Each receptor has sensory neurons at their tips. On receiving the information from the surrounding the start a nerve impulse. This is carried to the brain through the spinal cord. The information is transferred to different parts within the brain using relay neurons. After that, the response is again sent using nerve impulses, but this time through motor neurons. This information is passed to the effector where the response would be observed.

7 0
3 years ago
Redox reactions occur simultaneously: for every molecule that is reduced (gains electrons), another molecule is ______ (loses el
USPshnik [31]

Answer:

other molecule is OXIDISED

8 0
1 year ago
Many scientists have agreed that the organic molecules needed for life could have formed due to simple chemistry on early Earth.
Mrac [35]
I believe that the best answer to this question is d. amino acids. 
8 0
3 years ago
Read 2 more answers
2. in an experiment a student measured the maximum mass of sugar in grams that can dissolve in 100 mL of water
Ksenya-84 [330]

The appropriate title of the scatter plot is solubility curve of sugar

The independent variable is temperature

The dependent variable is mass of sugar in grams that can dissolve in 100 mL of water

The solubility curve is a graph of the amount of solute dissolved in a given volume of solvent against temperature.

The solubility of the solute is plotted on the vertical axis while the temperature is plotted on the horizontal axis.

The independent variable is the temperature while the dependent variable is mass of sugar in grams that can dissolve in 100 mL of water.

Learn more; brainly.com/question/8591226

4 0
3 years ago
Other questions:
  • Where do the reactions of the electron transport chain occur?
    7·2 answers
  • What kind of rock do you think a snickers bar would be? If it was a rock.. Igneous, metamorphic, obsidian, or sedimentary? (I mi
    5·2 answers
  • Why is it incorrect to say that mitochondria function only as energy factories with cell
    11·2 answers
  • Why is water important?
    6·2 answers
  • Glycolysis and the citric acid cycle comprise two different sets of oxidation reactions. thereaction sequence for glycolysis is
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Place in correct order the following steps in the process of appositional growth of cartilage. a: New matrix is produced and sec
    13·1 answer
  • How are meiosis and mitosis different​
    10·2 answers
  • What are some ways to deal with the population of lion fish in the Atlantic Ocean?
    15·1 answer
  • The spectrum of a distant star contains sodium lines that are offset from their normal position, as shown. What is the most like
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!