1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
3 years ago
13

Make a quick list of the foods that you eat during your last meal... hypothesize what would happen to the supply of those foods

if the suns energy was no longer available
Biology
1 answer:
nikklg [1K]3 years ago
5 0
Y hdkajbe jahdhve hahajene. HdhBd.
You might be interested in
What does a plant need before photosynthesis can happen? (check all that apply)
amid [387]
I think the answer is B,A,E
7 0
3 years ago
Which amino acid chain would be produced by the dna base sequence below?
Oliga [24]

In DNA, there is a code for the sequence of three bases for the placement of certain amino acid in a protein chain.<span> The amino acid chain that can be produced by the DNA base sequence of C-A-A-G-T-T-A-A-A-T-T-A-T-T-G-T-G-A would be based on the DNA code CAA is valine, GTT is glutamine, AAA is phenylalanine, TTA is asparagine, TTG is asparagine and TGA is threonine. </span>

4 0
3 years ago
What would MOST LIKELY happen to the grass if most of the fungi and bacteria die?
poizon [28]
The grass would probably not live!
4 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
What is the best estimate of the frequency of the wave shown below?
guapka [62]
B.......................
3 0
3 years ago
Read 2 more answers
Other questions:
  • Give three sources of error in the indirect method of determining systemic arterial blood pressure.
    15·1 answer
  • The graph below shows the light absorbance of two kinds of chlorophyll. mc007-1.jpg Which color of light does chlorophyll b abso
    5·1 answer
  • Fibers exiting the sympathetic chain ganglia, take one of three routes: the spinal nerve route, the sympathetic nerve route, and
    12·1 answer
  • Wich class of compounds does ammonia belong
    14·1 answer
  • Would an animal cell be able to survive without a mitochondria
    5·1 answer
  • The process of the plasma membrane pumping excess sodium out of a cell into an environment where there is a lower concentration
    10·1 answer
  • 06.01 formation of the solar system
    7·1 answer
  • How would the seasonal paths of the Sun change for a location that is more North of this latitude?
    14·2 answers
  • Very large, massive stars burn their fuel much ___________ than smaller stars.
    14·2 answers
  • Marisol is trying to get to work on time. She's walking to the bus
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!