1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondaur [170]
3 years ago
14

A woman was chopping vegetables when she accidentally cut her finger. A few days later, she observed a brownish layer on the wou

nd on her finger. Explain how the wound healed itself over time. Blood vessels dilate. Fibroblasts make collagen. There is an aggregation of platelets. Neutrophils consume the bacteria. The wound closes. Macrophages remove damaged tissue
Biology
1 answer:
qwelly [4]3 years ago
5 0

Answer:

this is the order

Explanation:

First, the blood vessels dilate to move blood to the area

Then, there's platelet's aggregation  to stop the bleeding

Fibroblasts make collagen to cicatrize the wound

Neutrophils consume the bacteria.

After that, the macrophages removes the damages tissues

And finally, the wound closes

You might be interested in
I'm asking this out of personal curiosity, not for school. but it's still for educational purposes kinda, so I hope it's okay.
lesantik [10]
I think it wouldn’t be dead until it looses all of its color and is able to crumple in your fingertips. So basically, it isn’t dead yet when it is wilted. But Its getting to the stage of being dead (like how old people are at that stage of their life where they will pass away soon).

To put it simply, the flower is not dead yet, it’s just “old” :D
8 0
2 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Help pls!
Nitella [24]

Answer:

A

Explanation:

Because

7 0
2 years ago
Help with the picture
Ipatiy [6.2K]
Bleaching I believe is the correct answer.
7 0
3 years ago
During the final stages of pregnancy, uterus prepares for the delivery of the baby. The release of hormone oxytocin during labor
BaLLatris [955]

Answer:

The Excretory System, The Reproductive System and The Endocrine System.

Explanation:

The Excretory System includes your bladder, uterus, and some of your organs. It is also called the "Urinary System". The Reproductive System includes your birth canal. This system helps to reproduce the body to have babies. The Endocrine System includes your hormones. It helps the body to depend on growth development or mood.

I hope this answers your question! :)

5 0
3 years ago
Other questions:
  • The line of latitude found at 0 is called the
    10·2 answers
  • Suppose you want to take pictures of your friend's soccer game. You'll be preparing your camera. How should you do it?
    8·1 answer
  • Jason’s team studied the________ , which measures incoming solar radiation and outgoing terrestrial infrared radiation.
    5·2 answers
  • Serval atmospheric gases contribute to global warming: carbon dioxide methane and nitrous oxide co differing this which choice w
    14·2 answers
  • Heterotrophs and consumers similarity
    5·1 answer
  • If a tRNA molecule has an anticodon which reads AUG, what was the codon of the mRNA molecule?
    7·1 answer
  • Our bodies do not make starch, but we often eat plant foods which contain starch which we digest into _____________, the buildin
    10·1 answer
  • Pleasee choose the correct answer
    8·2 answers
  • What is the water intake of chlorophytes​
    10·1 answer
  • In mice, black fur is dominant to white fur. Two mice with black fur are placed in the same cage and have several litters. Of al
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!