Given what we know, we can confirm that the scandal committed by the Secretary of the Interior who worked under President Taft was that he sold Alaskan coal lands that were supposed to be national parks.
<h3>Why is this important?</h3>
National parks are the way in which the government can preserve lands and protect the conservation of the organisms that inhabit those lands. The selling of these lands marked a major scandal at the time as they were considered shady dealings, shrouded in secrecy, that undermine conservative efforts.
Therefore, we can confirm that the answer is C, as he sold the Alaskan coal lands that were supposed to be protected national parks.
To learn more about national parks visit;
brainly.com/question/2510693?referrer=searchResults
Hydrocarbons. (organic compounds entirely made up of hydrogen and oxygen)
I think the answer would be pesticides... i see you selected it though. was that a wring answer?
Answer:
they burn no fuel and release no greenhouse gases
Explanation:
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.