I think it wouldn’t be dead until it looses all of its color and is able to crumple in your fingertips. So basically, it isn’t dead yet when it is wilted. But Its getting to the stage of being dead (like how old people are at that stage of their life where they will pass away soon).
To put it simply, the flower is not dead yet, it’s just “old” :D
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Bleaching I believe is the correct answer.
Answer:
The Excretory System, The Reproductive System and The Endocrine System.
Explanation:
The Excretory System includes your bladder, uterus, and some of your organs. It is also called the "Urinary System". The Reproductive System includes your birth canal. This system helps to reproduce the body to have babies. The Endocrine System includes your hormones. It helps the body to depend on growth development or mood.
I hope this answers your question! :)