1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Virty [35]
3 years ago
8

Which statement describes what occurs in both animal and plant cells?

Biology
1 answer:
snow_lady [41]3 years ago
3 0
Straight from the USAtestPrep interim exam - the answer is B.  
You might be interested in
Good things to say about the wright brothers in a presentation
Goryan [66]

Wilbur and Orville Wright were American inventors and pioneers of aviation. In 1903 the Wright brothers achieved the first powered, sustained and controlled airplane flight; they surpassed their own milestone two years later when they built and flew the first fully practical airplane.

5 0
3 years ago
In cats, curled ears result from an allele, Cu, that is dominant over an allele cu, for normal ears. Black color results from an
just olya [345]

Answer:

Explanation:

Cross : ggCuCu X GGcucu --------Parents

F1 progeny : GgCucu

Two of the F1 cats mate :

Cross : GgCucu X GgCucu

Gametes :

Gg X Gg = GG, Gg, Gg, gg

Cucu X Cucu = CuCu, Cucu, Cucu, cucu

1/4 GG X 1/4 CuCu = 1/16 GGCuCu (black - curled ears)

1/4 GG X 2/4 Cucu = 2/16 GGCucu (black - curled ears)

1/4 GG X 1/4 cucu = 1/16 GGcucu (black - normal ears)

2/4 Gg X 1/4 CuCu = 2/16 GgCuCu (black - curled ears)

2/4 Gg X 2/4 Cucu = 4/16 GgCucu (black - curled ears)

2/4 Gg X 1/4 cucu = 2/16 Ggcucu (black - normal ears)

1/4 gg X 1/4 CuCu = 1/16 ggCuCu (gray - curled ears)

1/4 gg X 2/4 Cucu = 2/16 ggCucu (gray - curled ears)

1/4 gg X 1/4 cucu = 1/16 ggcucu (gray - normal ears)

Answer : (i). 9/16 black cats, curled ears; 3/16 black cats, normal ears; 3/16 gray cats, curled ears; and 1/16 gray cats, normal ears.

An F1 cat mates with a stray cat that is gray and possesses normal ears :

Cross : GgCucu X ggcucu

Gametes :

Gg X gg = Gg, Gg, gg, gg

Cucu X cucu = Cucu, Cucu, cucu, cucu

2/4 Gg X 2/4 Cucu = 4/16 GgCucu (black - curled ears)

2/4 Gg X 2/4 cucu = 4/16 Ggcucu (black - normal ears)

2/4 gg X 2/4 Cucu = 4/16 ggCucu (gray - curled ears)

2/4 gg X 2/4 cucu = 4/16 ggcucu (gray - normal ears)

Answer : (i). 1/4 black cats, curled ears; 1/4 black cats, normal ears; 1/4 gray cats, curled ears; 1/4 gray cats, normal ears.

6 0
4 years ago
Suppose you observe a bird with a very broad and thick beak. You want to know why the bird’s beak is shaped that way. How could
Pie

All of them!! Just took the test.

3 0
3 years ago
Read 2 more answers
Organisms must maintain _____, which is a balance of internal conditions.
Brums [2.3K]
That would be homeostasis
7 0
3 years ago
Read 2 more answers
Water is an important biomolecule. o True False​
Natasha2012 [34]

Explanation:

Proteins and nucleic acids play important biological functions : they catalyze and regulate reactions, transport substrates, code and transcribe genetic information. It is widely appreciated that water molecules play an invaluable role in governing the structure, stability, dynamic, and function of these biomolecules

Water, without any doubt, must be considered an integral part of biological macromolecules. The living world should be thought of as an equal partnership between proteins, nucleic acids and water

7 0
4 years ago
Other questions:
  • The tissue(s) that is/are considered excitable because of the ability to generate electrical signals is/are called ________ tiss
    8·1 answer
  • Explain why the growing of willow for biofuel is an example of sustainable development.
    15·1 answer
  • What is the struggle for food space and other limited resources called?
    8·1 answer
  • Many droplets of water join together and fall to earth as?
    7·2 answers
  • The most common type of joint which are freely movable are called
    15·1 answer
  • Which of the following is a risk of commercial fishing?
    13·2 answers
  • The original cell theory has been expanded upon since it was first developed to include further additions
    7·1 answer
  • For stomata to close, which of the following must occur?
    13·1 answer
  • How does the thyroid gland help maintain and regulate calcium?
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!