1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Annette [7]
4 years ago
12

What is the hazy layer that surrounds a comet's nucleus?

Biology
1 answer:
Lina20 [59]4 years ago
4 0
A hazy cloud called a coma surrounds the nucleus. The coma and the nucleus together form the comet's head.
You might be interested in
Which of the following function is NOT a function of ground tissue in a plant?
solong [7]
The answer is b)produces sugars
8 0
3 years ago
Read 2 more answers
What's the main characteristic of porosity?
aev [14]

Answer:

The answer should be D

Explanation:

because poroslty of a rock is a measure of its ability to hold a fluid. mathematically, it is the open space in rock divided by the total rock volume.

6 0
3 years ago
Which does not occur at the continental margin in the Pacific Ocean?
SCORPION-xisa [38]

Answer:

Widen Margins occurs at the continental margin in the pacific ocean, so the answer is:

1. Widened Margins.

3 0
3 years ago
What are the two main ways a star can live based on it mass?
Andrej [43]

Answer:

Main sequence stars fuse hydrogen atoms to form helium atoms in their cores. About 90 percent of the stars in the universe, including the sun, are main sequence stars. These stars can range from about a tenth of the mass of the sun to up to 200 times as massive.

Stars start their lives as clouds of dust and gas. Gravity draws these clouds together. A small protostar forms, powered by the collapsing material. Protostars often form in densely packed clouds of gas and can be challenging to detect.

"Nature doesn't form stars in isolation," Mark Morris, of the University of California at Los Angeles (UCLS), said in a statement. "It forms them in clusters, out of natal clouds that collapse under their own gravity."

Smaller bodies — with less than 0.08 the sun's mass — cannot reach the stage of nuclear fusion at their core. Instead, they become brown dwarfs, stars that never ignite. But if the body has sufficient mass, the collapsing gas and dust burns hotter, eventually reaching temperatures sufficient to fuse hydrogen into helium. The star turns on and becomes a main sequence star, powered by hydrogen fusion. Fusion produces an outward pressure that balances with the inward pressure caused by gravity, stabilizing the star.

How long a main sequence star lives depends on how massive it is. A higher-mass star may have more material, but it burns through it faster due to higher core temperatures caused by greater gravitational forces. While the sun will spend about 10 billion years on the main sequence, a star 10 times as massive will stick around for only 20 million years. A red dwarf, which is half as massive as the sun, can last 80 to 100 billion years, which is far longer than the universe's age of 13.8 billion years. (This long lifetime is one reason red dwarfs are considered to be good sources for planets hosting life, because they are stable for such a long time.)

Explanation:

I hope this helped!

3 0
3 years ago
Read 2 more answers
A rock that forms when magma hardens beneath Earth’s surface is called an _____. intrusive igneous rock extrusive metamorphic ro
Karo-lina-s [1.5K]
A rock that forms when magma hardens beneath Earth's surface is called an intrusive igneous rock.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Describe how a farmer can maintain Genetic Stability in his crops??
    10·1 answer
  • Explain how the lungs and circulatory system work together?
    12·2 answers
  • Which of the following typical adaptations of marine animals is not found in sea otters?
    13·2 answers
  • Why do certain bacteria become endospores?
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What events must have occurred for fossils of marne organisms to be in a mountain far above sea level?​
    14·1 answer
  • The graph shows how a Serengeti Buffalo population changed over a period of years. At the beginning of the time period, the buff
    11·1 answer
  • Select the correct answer from each drop-down menu.
    10·1 answer
  • Write the definition for the word Proliferation IN YOUR OWN WORDS.
    13·2 answers
  • Scientific question: Why does a dog circle its
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!