The type of inversion is Paracentric inversion.
There are two types of inversion at the chromosome level, depending on the centromere:
Paracentric inversions:
the centromere is not included in the inversion.
Pericentric inversions:
The centromere is included in the inversion which can transform a metacentric chromosome into an acrocentric chromosome.
the structure that will form during synapsis is inversion loop.
These inversions are balanced rearrangements but at the moment of meiosis they cause difficulties in pairing. There is most often formation of a pairing loop. The occurrence of recombination in the inverted segment causes the formation of abnormal gametes by duplication / impairment.
people procrastinate because they're avoiding something they know will make them emotionally unpleasant by doing that task, so instead, they do something that provides a temporary mood boost. Procrastination itself causes shame and guilt, leading people to procrastinate even further.
your physical abilities rely a lot on your mental strength, if you feel like you've been procrastinating, try doing things to boost your overall mental health.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
A synonym for observation could be remark.
Interphase: Chromosomes duplicate, and the copies remain attached to each other.
Prophase: In the nucleus, chromosomes condense and become visible. Spindle fibers begin to form.
Prometaphase: The nulcear membrane breaks apart, and the spindle starts to interact with the chromosomes.
Metaphase: The copied chromosomes align in the middle of the spindle.
Anaphase: Chromosomes separate into two genetically identical groups and move to opposite ends of the spindle.
Telophase: Nuclear membranes form around each of the two sets of chromosomes, they begin to spread out, and the spindle begins to break down.
Cytokinesis: The two cells split into two daughter cells, each with the same number of chromosomes as the parent cell.
