1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
6

Why is the nervous system referred to as a communication system?

Biology
1 answer:
Anna35 [415]3 years ago
7 0
The nervous system is referred to as a communication system because it carries messages to and from all parts of the body.


You might be interested in
How are proteins related to the cell membrane? DNA
Elanso [62]

Answer:

DNA carries the genetic information for making proteins. ... The base sequence determines amino acid sequence in protein. Messenger RNA (mRNA) is a molecule which carries a copy of the code from the DNA, in the nucleus, to a ribosome, where the protein is assembled from amino acids.

4 0
3 years ago
Which of the following situations or phrases most accurately describes the citric acid cycle?
Bond [772]

The correct answer is: B) "All roads lead to Rome"

Citric acid cycle also called tricarboxylic acid (TCA) cycle and Krebs cycle is a central process in cellular respiration. Citric acid cycle that connects carbohydrate, fat, and protein metabolism so “all the roads” from the different metabolic pathways come to this cycle.

Acetyl-CoA which is produced through the oxidation of pyruvate (pyruvate is a product of glycolysis) enters the cycle which then produces reduced electron carriers NADH, FAD2 and energy molecule ATP. These electron carriers will then pass their electrons into the electron transport chain and, through the process of oxidative phosphorylation, will produce more ATP.

7 0
3 years ago
A study has shown 75% of teenage boys drink 1 liter of soda per day. How many 250 ML cans of soda would a boy drink in a week if
victus00 [196]
28 cans of 250 ML soda in a week.
5 0
3 years ago
True or false the center of the earth is very hot
Fantom [35]

Answer:

true very true

4 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • Compare and contrast solids and liquids
    10·1 answer
  • What is the part of a cow that releases milk?
    6·1 answer
  • What is the opposite of evaporation? How do these processes differ?
    6·2 answers
  • Some scientists believe that global warming will bring about extreme weather.
    9·2 answers
  • What role does ubiquinone have in electron transport and what is the mode of action?
    11·1 answer
  • This is and organism that relies on other for its food and energy supply
    9·2 answers
  • 2Ba(OH)2<br><br> Ba = <br><br> O = <br><br> H =
    9·1 answer
  • What is a nucleotide? What is an amino acid? What is a simple sugar (glucose)? What do these three share in common?
    9·1 answer
  • Please help I am confused
    11·1 answer
  • Excitatory stimuli generally cause the membrane potential of a neuron to
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!